FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637553_at:

>probe:Drosophila_2:1637553_at:435:617; Interrogation_Position=106; Antisense; TGCAGCAGTTCATCCACTCGAGTAG
>probe:Drosophila_2:1637553_at:524:487; Interrogation_Position=127; Antisense; GTAGCGCCACGAATATTGCGAACCA
>probe:Drosophila_2:1637553_at:309:697; Interrogation_Position=203; Antisense; TTTACATGGCGCTGGTAGCTTTCTG
>probe:Drosophila_2:1637553_at:329:117; Interrogation_Position=219; Antisense; AGCTTTCTGCGCGACAATTTCATGA
>probe:Drosophila_2:1637553_at:419:161; Interrogation_Position=232; Antisense; ACAATTTCATGAGCAACTCGGCCAG
>probe:Drosophila_2:1637553_at:153:117; Interrogation_Position=255; Antisense; AGCTCTGCTCTGAATGCCATAATGG
>probe:Drosophila_2:1637553_at:681:113; Interrogation_Position=334; Antisense; AGCAGCTCCAGATAAGTGCCTCGCC
>probe:Drosophila_2:1637553_at:457:317; Interrogation_Position=426; Antisense; GCCGGAGTCGTTGGCAGCATATCCT
>probe:Drosophila_2:1637553_at:137:117; Interrogation_Position=441; Antisense; AGCATATCCTTTGGCGCCACTGAAT
>probe:Drosophila_2:1637553_at:206:711; Interrogation_Position=514; Antisense; TTCAGCGACGTCTGGCGAAAAGCTT
>probe:Drosophila_2:1637553_at:466:183; Interrogation_Position=531; Antisense; AAAAGCTTCAGCGTAGCACCTACCA
>probe:Drosophila_2:1637553_at:708:159; Interrogation_Position=560; Antisense; ACAACAGAAGGGTGCGGCTCTCCAC
>probe:Drosophila_2:1637553_at:561:337; Interrogation_Position=576; Antisense; GCTCTCCACGGAGAATCTCTATTTG
>probe:Drosophila_2:1637553_at:661:339; Interrogation_Position=646; Antisense; GCTAAAACTTTATCCTGGCAGTGGT

Paste this into a BLAST search page for me
TGCAGCAGTTCATCCACTCGAGTAGGTAGCGCCACGAATATTGCGAACCATTTACATGGCGCTGGTAGCTTTCTGAGCTTTCTGCGCGACAATTTCATGAACAATTTCATGAGCAACTCGGCCAGAGCTCTGCTCTGAATGCCATAATGGAGCAGCTCCAGATAAGTGCCTCGCCGCCGGAGTCGTTGGCAGCATATCCTAGCATATCCTTTGGCGCCACTGAATTTCAGCGACGTCTGGCGAAAAGCTTAAAAGCTTCAGCGTAGCACCTACCAACAACAGAAGGGTGCGGCTCTCCACGCTCTCCACGGAGAATCTCTATTTGGCTAAAACTTTATCCTGGCAGTGGT

Full Affymetrix probeset data:

Annotations for 1637553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720