FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637555_at:

>probe:Drosophila_2:1637555_at:35:485; Interrogation_Position=1027; Antisense; GTATGACTCTTACCTTCCAGCAAGA
>probe:Drosophila_2:1637555_at:696:241; Interrogation_Position=1064; Antisense; AATTTGTGCCCCTGTAGGCGGCGAA
>probe:Drosophila_2:1637555_at:138:53; Interrogation_Position=1137; Antisense; ATGAAGTTCACCATACCGGGCAAGG
>probe:Drosophila_2:1637555_at:601:455; Interrogation_Position=1163; Antisense; GTTCGTTCCGAAACCACAGGTGGAT
>probe:Drosophila_2:1637555_at:222:289; Interrogation_Position=1193; Antisense; CGTCGTCAAGCTAATTCCCCTAAAG
>probe:Drosophila_2:1637555_at:670:169; Interrogation_Position=1214; Antisense; AAAGCGCCCTAAGACTCAATTGCCG
>probe:Drosophila_2:1637555_at:209:243; Interrogation_Position=1231; Antisense; AATTGCCGTTTCACCTAGTTGAGCG
>probe:Drosophila_2:1637555_at:125:679; Interrogation_Position=1246; Antisense; TAGTTGAGCGCGTAGTCCGTCACAT
>probe:Drosophila_2:1637555_at:177:495; Interrogation_Position=1264; Antisense; GTCACATCTTTAGCATGCGCCAGAA
>probe:Drosophila_2:1637555_at:252:423; Interrogation_Position=1347; Antisense; GAGAAGCTATTTCAGCGCGCCGAAG
>probe:Drosophila_2:1637555_at:623:335; Interrogation_Position=1382; Antisense; GCTGCGTCCCTTTGAACTAACTGTG
>probe:Drosophila_2:1637555_at:54:371; Interrogation_Position=1428; Antisense; GAAGTCTATTCGGAGCATCTGGTGA
>probe:Drosophila_2:1637555_at:507:81; Interrogation_Position=1462; Antisense; AGGTGGCTGCCTATGATTACCGGGC
>probe:Drosophila_2:1637555_at:83:173; Interrogation_Position=1510; Antisense; AAAGCAACGATTTCACTCCTGTTTA

Paste this into a BLAST search page for me
GTATGACTCTTACCTTCCAGCAAGAAATTTGTGCCCCTGTAGGCGGCGAAATGAAGTTCACCATACCGGGCAAGGGTTCGTTCCGAAACCACAGGTGGATCGTCGTCAAGCTAATTCCCCTAAAGAAAGCGCCCTAAGACTCAATTGCCGAATTGCCGTTTCACCTAGTTGAGCGTAGTTGAGCGCGTAGTCCGTCACATGTCACATCTTTAGCATGCGCCAGAAGAGAAGCTATTTCAGCGCGCCGAAGGCTGCGTCCCTTTGAACTAACTGTGGAAGTCTATTCGGAGCATCTGGTGAAGGTGGCTGCCTATGATTACCGGGCAAAGCAACGATTTCACTCCTGTTTA

Full Affymetrix probeset data:

Annotations for 1637555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720