Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637556_at:

>probe:Drosophila_2:1637556_at:191:175; Interrogation_Position=1242; Antisense; AAACCACCGCAGATCATTGCCATTG
>probe:Drosophila_2:1637556_at:552:453; Interrogation_Position=1253; Antisense; GATCATTGCCATTGAGGACTACTAG
>probe:Drosophila_2:1637556_at:307:393; Interrogation_Position=1279; Antisense; GAAAGCTACCGAAAGCAGCCCGGAA
>probe:Drosophila_2:1637556_at:385:321; Interrogation_Position=1296; Antisense; GCCCGGAATGGGAACCAGCAGCATA
>probe:Drosophila_2:1637556_at:394:203; Interrogation_Position=1308; Antisense; AACCAGCAGCATAACATCAACCAGA
>probe:Drosophila_2:1637556_at:367:701; Interrogation_Position=1351; Antisense; TTTTCCTTTTCGGTTTGTGTAGCAT
>probe:Drosophila_2:1637556_at:377:487; Interrogation_Position=1369; Antisense; GTAGCATTTTTCGTTTCACTGTTGA
>probe:Drosophila_2:1637556_at:176:649; Interrogation_Position=1384; Antisense; TCACTGTTGAGTTGTCGTACGGCGT
>probe:Drosophila_2:1637556_at:626:499; Interrogation_Position=1397; Antisense; GTCGTACGGCGTCTTGTGCAAAATA
>probe:Drosophila_2:1637556_at:177:255; Interrogation_Position=1497; Antisense; CAAACGATACCGAAATACTGCAGAT
>probe:Drosophila_2:1637556_at:697:669; Interrogation_Position=1512; Antisense; TACTGCAGATCAGCTCTAATTTAGT
>probe:Drosophila_2:1637556_at:636:677; Interrogation_Position=1533; Antisense; TAGTTTTTCATCCTAATCCTAACAA
>probe:Drosophila_2:1637556_at:634:485; Interrogation_Position=1585; Antisense; GTAGACTTACTGTATTTGAATCCAA
>probe:Drosophila_2:1637556_at:259:373; Interrogation_Position=1766; Antisense; GAAGTGTACACTGGGTGCGTCTTAT

Paste this into a BLAST search page for me
AAACCACCGCAGATCATTGCCATTGGATCATTGCCATTGAGGACTACTAGGAAAGCTACCGAAAGCAGCCCGGAAGCCCGGAATGGGAACCAGCAGCATAAACCAGCAGCATAACATCAACCAGATTTTCCTTTTCGGTTTGTGTAGCATGTAGCATTTTTCGTTTCACTGTTGATCACTGTTGAGTTGTCGTACGGCGTGTCGTACGGCGTCTTGTGCAAAATACAAACGATACCGAAATACTGCAGATTACTGCAGATCAGCTCTAATTTAGTTAGTTTTTCATCCTAATCCTAACAAGTAGACTTACTGTATTTGAATCCAAGAAGTGTACACTGGGTGCGTCTTAT

Full Affymetrix probeset data:

Annotations for 1637556_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime