Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637558_at:

>probe:Drosophila_2:1637558_at:374:215; Interrogation_Position=2028; Antisense; AAGATCCGCGATTCCGCTAATTACA
>probe:Drosophila_2:1637558_at:104:219; Interrogation_Position=2070; Antisense; AAGTGCGACCACAACGGATTTCCGG
>probe:Drosophila_2:1637558_at:179:543; Interrogation_Position=2085; Antisense; GGATTTCCGGTGGTCGATGATGTTT
>probe:Drosophila_2:1637558_at:146:435; Interrogation_Position=2127; Antisense; GAGGGTCGCGTTTGTGGCATCATCT
>probe:Drosophila_2:1637558_at:322:275; Interrogation_Position=2150; Antisense; CTTGCGCTCGCAACTGATTGTTATT
>probe:Drosophila_2:1637558_at:667:15; Interrogation_Position=2172; Antisense; ATTTTGCTCAAATCCCTGTATGTGG
>probe:Drosophila_2:1637558_at:554:107; Interrogation_Position=2197; Antisense; AGAACAAACGATTCTGGCTGCCAGA
>probe:Drosophila_2:1637558_at:616:245; Interrogation_Position=2228; Antisense; AATTCAGACATTCAGGGACCTCTAT
>probe:Drosophila_2:1637558_at:505:631; Interrogation_Position=2252; Antisense; TCCCCGTTTTCCATCAATCAAGAGT
>probe:Drosophila_2:1637558_at:355:403; Interrogation_Position=2313; Antisense; GACTTGTCCATGTTTATGAATCCAT
>probe:Drosophila_2:1637558_at:451:233; Interrogation_Position=2331; Antisense; AATCCATCACCTATTCGAGTCAATC
>probe:Drosophila_2:1637558_at:489:235; Interrogation_Position=2352; Antisense; AATCCGCACGATTCGGTGCCTAGAA
>probe:Drosophila_2:1637558_at:238:17; Interrogation_Position=2376; Antisense; ATTTTTCAGATATTCCGCGCATTGG
>probe:Drosophila_2:1637558_at:44:541; Interrogation_Position=2401; Antisense; GGTTGCGTCATTTGCTGGTCATCAA

Paste this into a BLAST search page for me
AAGATCCGCGATTCCGCTAATTACAAAGTGCGACCACAACGGATTTCCGGGGATTTCCGGTGGTCGATGATGTTTGAGGGTCGCGTTTGTGGCATCATCTCTTGCGCTCGCAACTGATTGTTATTATTTTGCTCAAATCCCTGTATGTGGAGAACAAACGATTCTGGCTGCCAGAAATTCAGACATTCAGGGACCTCTATTCCCCGTTTTCCATCAATCAAGAGTGACTTGTCCATGTTTATGAATCCATAATCCATCACCTATTCGAGTCAATCAATCCGCACGATTCGGTGCCTAGAAATTTTTCAGATATTCCGCGCATTGGGGTTGCGTCATTTGCTGGTCATCAA

Full Affymetrix probeset data:

Annotations for 1637558_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime