FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637559_at:

>probe:Drosophila_2:1637559_at:260:231; Interrogation_Position=505; Antisense; AATGACGCGAGTGCTGGCTGATCTA
>probe:Drosophila_2:1637559_at:688:571; Interrogation_Position=520; Antisense; GGCTGATCTAGATTCGCGAAACATT
>probe:Drosophila_2:1637559_at:550:325; Interrogation_Position=535; Antisense; GCGAAACATTTTCCGGTGGCACAAG
>probe:Drosophila_2:1637559_at:140:463; Interrogation_Position=565; Antisense; GATTCAGGAATACGTGCCCTTCGAT
>probe:Drosophila_2:1637559_at:528:413; Interrogation_Position=602; Antisense; GACCAGAGTGCCAGCGCCAGGAATC
>probe:Drosophila_2:1637559_at:551:471; Interrogation_Position=634; Antisense; GTTCGACAGCTTATATGACCCGCAA
>probe:Drosophila_2:1637559_at:324:115; Interrogation_Position=774; Antisense; AGCAGTCTCTGGGAGAGGCAGCCAC
>probe:Drosophila_2:1637559_at:408:183; Interrogation_Position=826; Antisense; AAAAGCAGCCGACCTTTGACCAAAG
>probe:Drosophila_2:1637559_at:571:567; Interrogation_Position=852; Antisense; GGCAGCTAGAGCAGGATCTGGCCCT
>probe:Drosophila_2:1637559_at:390:41; Interrogation_Position=867; Antisense; ATCTGGCCCTGCTCATGATGGCAGT
>probe:Drosophila_2:1637559_at:329:547; Interrogation_Position=898; Antisense; GGAGGAACAGTAAGGCCGCCCGCTT
>probe:Drosophila_2:1637559_at:254:665; Interrogation_Position=924; Antisense; TACACATTCAACCTGCAGACCATTT
>probe:Drosophila_2:1637559_at:680:263; Interrogation_Position=939; Antisense; CAGACCATTTCATCAGTGCTAGTTA
>probe:Drosophila_2:1637559_at:30:165; Interrogation_Position=969; Antisense; AAATCGCGTGTTACCATTTCGTACT

Paste this into a BLAST search page for me
AATGACGCGAGTGCTGGCTGATCTAGGCTGATCTAGATTCGCGAAACATTGCGAAACATTTTCCGGTGGCACAAGGATTCAGGAATACGTGCCCTTCGATGACCAGAGTGCCAGCGCCAGGAATCGTTCGACAGCTTATATGACCCGCAAAGCAGTCTCTGGGAGAGGCAGCCACAAAAGCAGCCGACCTTTGACCAAAGGGCAGCTAGAGCAGGATCTGGCCCTATCTGGCCCTGCTCATGATGGCAGTGGAGGAACAGTAAGGCCGCCCGCTTTACACATTCAACCTGCAGACCATTTCAGACCATTTCATCAGTGCTAGTTAAAATCGCGTGTTACCATTTCGTACT

Full Affymetrix probeset data:

Annotations for 1637559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720