FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637560_at:

>probe:Drosophila_2:1637560_at:400:655; Interrogation_Position=5073; Antisense; TAATTTCTCGATTCACTACAAGGAC
>probe:Drosophila_2:1637560_at:534:473; Interrogation_Position=5102; Antisense; GTTACAAGCTTGAGTCCGAAACCTT
>probe:Drosophila_2:1637560_at:116:271; Interrogation_Position=5139; Antisense; CATACCGGTTTTGCAGAGATACATT
>probe:Drosophila_2:1637560_at:414:375; Interrogation_Position=5173; Antisense; GAAGACCACCAACTTGAATGTTTAT
>probe:Drosophila_2:1637560_at:274:369; Interrogation_Position=5188; Antisense; GAATGTTTATATACTTTGCAGCTTT
>probe:Drosophila_2:1637560_at:23:619; Interrogation_Position=5204; Antisense; TGCAGCTTTTAGTTCATGGATTGGA
>probe:Drosophila_2:1637560_at:180:271; Interrogation_Position=5230; Antisense; CATCCAAGAGGGTTGCTGAGTGAAC
>probe:Drosophila_2:1637560_at:501:285; Interrogation_Position=5245; Antisense; CTGAGTGAACTAATTGGCGAGCTAT
>probe:Drosophila_2:1637560_at:107:327; Interrogation_Position=5261; Antisense; GCGAGCTATATGATGCCTTTGTAAT
>probe:Drosophila_2:1637560_at:8:265; Interrogation_Position=5287; Antisense; CAGAAGGAATCGCTTTGTAAGTGGC
>probe:Drosophila_2:1637560_at:617:461; Interrogation_Position=5314; Antisense; GATTCAAAGGATCAGTCTGCTGGCA
>probe:Drosophila_2:1637560_at:600:523; Interrogation_Position=5340; Antisense; GGGCGTTGCTGTAAAAAGTCTTAAT
>probe:Drosophila_2:1637560_at:342:443; Interrogation_Position=5389; Antisense; GATGATGCCAACTAAAAGTGACCTA
>probe:Drosophila_2:1637560_at:625:31; Interrogation_Position=5517; Antisense; ATAACGCTATGCTTCTGGTTCATGC

Paste this into a BLAST search page for me
TAATTTCTCGATTCACTACAAGGACGTTACAAGCTTGAGTCCGAAACCTTCATACCGGTTTTGCAGAGATACATTGAAGACCACCAACTTGAATGTTTATGAATGTTTATATACTTTGCAGCTTTTGCAGCTTTTAGTTCATGGATTGGACATCCAAGAGGGTTGCTGAGTGAACCTGAGTGAACTAATTGGCGAGCTATGCGAGCTATATGATGCCTTTGTAATCAGAAGGAATCGCTTTGTAAGTGGCGATTCAAAGGATCAGTCTGCTGGCAGGGCGTTGCTGTAAAAAGTCTTAATGATGATGCCAACTAAAAGTGACCTAATAACGCTATGCTTCTGGTTCATGC

Full Affymetrix probeset data:

Annotations for 1637560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720