FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637562_at:

>probe:Drosophila_2:1637562_at:236:561; Interrogation_Position=1037; Antisense; TGGAAAGTCCGGACCCTACTAAATG
>probe:Drosophila_2:1637562_at:645:65; Interrogation_Position=1059; Antisense; ATGGATCTTCAACCCATCGTGAACT
>probe:Drosophila_2:1637562_at:531:621; Interrogation_Position=1115; Antisense; TGCTGACTAGTCCTGTCGTTGACAC
>probe:Drosophila_2:1637562_at:296:19; Interrogation_Position=1156; Antisense; ATTTGAGTACCACATCATCCACATC
>probe:Drosophila_2:1637562_at:635:261; Interrogation_Position=1207; Antisense; CACCATGTGTCCCTGAATTATCTCA
>probe:Drosophila_2:1637562_at:35:281; Interrogation_Position=1228; Antisense; CTCAGATTTGCATCACTCCTTTTAA
>probe:Drosophila_2:1637562_at:702:717; Interrogation_Position=1269; Antisense; TTCGCCCACGACTTTTGTACATAAT
>probe:Drosophila_2:1637562_at:78:405; Interrogation_Position=1325; Antisense; GACTATCCACCTTTTTGCATCTGTA
>probe:Drosophila_2:1637562_at:18:347; Interrogation_Position=1341; Antisense; GCATCTGTACATTTTTCACCTTCAA
>probe:Drosophila_2:1637562_at:446:245; Interrogation_Position=1369; Antisense; AATTAGAGTCTAACCTTCAGCCCTG
>probe:Drosophila_2:1637562_at:272:261; Interrogation_Position=1386; Antisense; CAGCCCTGCCTGGAAAATTCTATTA
>probe:Drosophila_2:1637562_at:136:239; Interrogation_Position=1414; Antisense; AATAGGCGACAAGTGCGGGTTCCTT
>probe:Drosophila_2:1637562_at:706:455; Interrogation_Position=1432; Antisense; GTTCCTTGGATGGTAACCTCACCTG
>probe:Drosophila_2:1637562_at:683:577; Interrogation_Position=1517; Antisense; GGCCTGACTTGCTCCATACATATAA

Paste this into a BLAST search page for me
TGGAAAGTCCGGACCCTACTAAATGATGGATCTTCAACCCATCGTGAACTTGCTGACTAGTCCTGTCGTTGACACATTTGAGTACCACATCATCCACATCCACCATGTGTCCCTGAATTATCTCACTCAGATTTGCATCACTCCTTTTAATTCGCCCACGACTTTTGTACATAATGACTATCCACCTTTTTGCATCTGTAGCATCTGTACATTTTTCACCTTCAAAATTAGAGTCTAACCTTCAGCCCTGCAGCCCTGCCTGGAAAATTCTATTAAATAGGCGACAAGTGCGGGTTCCTTGTTCCTTGGATGGTAACCTCACCTGGGCCTGACTTGCTCCATACATATAA

Full Affymetrix probeset data:

Annotations for 1637562_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720