Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637564_a_at:

>probe:Drosophila_2:1637564_a_at:640:433; Interrogation_Position=1036; Antisense; GAGGGCTGGAATAACCCCAATCCAC
>probe:Drosophila_2:1637564_a_at:419:679; Interrogation_Position=1078; Antisense; TAGGGTGTGCATTCACGGTCGAAAT
>probe:Drosophila_2:1637564_a_at:346:1; Interrogation_Position=1128; Antisense; TCCAAGTCCCCGATTCCGAAAGAAT
>probe:Drosophila_2:1637564_a_at:163:575; Interrogation_Position=645; Antisense; GGCGGCTGTCAGCAACATGACCAAA
>probe:Drosophila_2:1637564_a_at:89:57; Interrogation_Position=661; Antisense; ATGACCAAAGTGCACCACATCCATT
>probe:Drosophila_2:1637564_a_at:207:153; Interrogation_Position=677; Antisense; ACATCCATTCCGGTGGCGAGCGAGA
>probe:Drosophila_2:1637564_a_at:335:417; Interrogation_Position=694; Antisense; GAGCGAGAGCGCACGAAGCCCAATG
>probe:Drosophila_2:1637564_a_at:495:575; Interrogation_Position=781; Antisense; GGCGACTACGCCAGCAGCAGAAGAC
>probe:Drosophila_2:1637564_a_at:344:303; Interrogation_Position=816; Antisense; CCGTCAGTCGCCAATTGGTGGGACA
>probe:Drosophila_2:1637564_a_at:505:453; Interrogation_Position=850; Antisense; GATAATAAGTACCAGCGCCGCACTC
>probe:Drosophila_2:1637564_a_at:228:247; Interrogation_Position=881; Antisense; AATTGTTCTCGCGATGGACACGCCG
>probe:Drosophila_2:1637564_a_at:100:583; Interrogation_Position=934; Antisense; TGGCGTCGCACTTGGTTCCTGGTGA
>probe:Drosophila_2:1637564_a_at:589:11; Interrogation_Position=967; Antisense; ATTTTGGCCTTTGTCTTGTTCGTCT
>probe:Drosophila_2:1637564_a_at:685:725; Interrogation_Position=982; Antisense; TTGTTCGTCTATCTTATGGCCTGGC

Paste this into a BLAST search page for me
GAGGGCTGGAATAACCCCAATCCACTAGGGTGTGCATTCACGGTCGAAATTCCAAGTCCCCGATTCCGAAAGAATGGCGGCTGTCAGCAACATGACCAAAATGACCAAAGTGCACCACATCCATTACATCCATTCCGGTGGCGAGCGAGAGAGCGAGAGCGCACGAAGCCCAATGGGCGACTACGCCAGCAGCAGAAGACCCGTCAGTCGCCAATTGGTGGGACAGATAATAAGTACCAGCGCCGCACTCAATTGTTCTCGCGATGGACACGCCGTGGCGTCGCACTTGGTTCCTGGTGAATTTTGGCCTTTGTCTTGTTCGTCTTTGTTCGTCTATCTTATGGCCTGGC

Full Affymetrix probeset data:

Annotations for 1637564_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime