FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637567_at:

>probe:Drosophila_2:1637567_at:617:287; Interrogation_Position=1272; Antisense; CGGCGAGAACCGCATCGACTTGATG
>probe:Drosophila_2:1637567_at:58:329; Interrogation_Position=1322; Antisense; GCGTGAGCATCACTTATCAGGGAGA
>probe:Drosophila_2:1637567_at:60:143; Interrogation_Position=1350; Antisense; ACTGGGAATGACTGACCTGGACATC
>probe:Drosophila_2:1637567_at:718:577; Interrogation_Position=1401; Antisense; GGCCTGCAATTCCAACTCGGATATT
>probe:Drosophila_2:1637567_at:623:17; Interrogation_Position=1423; Antisense; ATTTACGAGCAGTTCACTCGCGATC
>probe:Drosophila_2:1637567_at:413:55; Interrogation_Position=1475; Antisense; ATGAGGCCAACGCAGGTTTCTCCAC
>probe:Drosophila_2:1637567_at:70:71; Interrogation_Position=1553; Antisense; AGGCGGAGAATTCCACGAGTCCCAG
>probe:Drosophila_2:1637567_at:378:503; Interrogation_Position=1571; Antisense; GTCCCAGCCACTTGAGCTTGTACAA
>probe:Drosophila_2:1637567_at:3:173; Interrogation_Position=1620; Antisense; AAAGACTCTGCAGTTTGGCGCCACT
>probe:Drosophila_2:1637567_at:433:581; Interrogation_Position=1635; Antisense; TGGCGCCACTCGATATGCGAATGTG
>probe:Drosophila_2:1637567_at:51:671; Interrogation_Position=1708; Antisense; TACGTGCTGGTTGCCAATGTGCTGG
>probe:Drosophila_2:1637567_at:580:229; Interrogation_Position=1723; Antisense; AATGTGCTGGACACCAGTGTCTCTG
>probe:Drosophila_2:1637567_at:266:565; Interrogation_Position=1747; Antisense; GGAATAGACGTAGCCAGTGCCATAT
>probe:Drosophila_2:1637567_at:288:87; Interrogation_Position=1762; Antisense; AGTGCCATATATGCGACTGGTAGCT

Paste this into a BLAST search page for me
CGGCGAGAACCGCATCGACTTGATGGCGTGAGCATCACTTATCAGGGAGAACTGGGAATGACTGACCTGGACATCGGCCTGCAATTCCAACTCGGATATTATTTACGAGCAGTTCACTCGCGATCATGAGGCCAACGCAGGTTTCTCCACAGGCGGAGAATTCCACGAGTCCCAGGTCCCAGCCACTTGAGCTTGTACAAAAAGACTCTGCAGTTTGGCGCCACTTGGCGCCACTCGATATGCGAATGTGTACGTGCTGGTTGCCAATGTGCTGGAATGTGCTGGACACCAGTGTCTCTGGGAATAGACGTAGCCAGTGCCATATAGTGCCATATATGCGACTGGTAGCT

Full Affymetrix probeset data:

Annotations for 1637567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720