FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637568_at:

>probe:Drosophila_2:1637568_at:154:703; Interrogation_Position=1001; Antisense; TTATTTGCCCGCGAACCAGTTCTAA
>probe:Drosophila_2:1637568_at:690:217; Interrogation_Position=1024; Antisense; AAGTATTCTTCATTGCTCGTCACAT
>probe:Drosophila_2:1637568_at:345:621; Interrogation_Position=1037; Antisense; TGCTCGTCACATCCAGATCTAGTTA
>probe:Drosophila_2:1637568_at:478:707; Interrogation_Position=1059; Antisense; TTAGCTGTCATCAACACCACTTAGG
>probe:Drosophila_2:1637568_at:537:219; Interrogation_Position=1087; Antisense; AAGTGCTTGCCAATGTTACCCAAAT
>probe:Drosophila_2:1637568_at:654:161; Interrogation_Position=580; Antisense; ACAATGTGCTGTTCGTCAAGACGCC
>probe:Drosophila_2:1637568_at:589:729; Interrogation_Position=636; Antisense; TTGGCCAAGACCCTTAAGCAGGAGA
>probe:Drosophila_2:1637568_at:556:211; Interrogation_Position=660; Antisense; AAGACCGTGGTCTATGTGCTGGCCA
>probe:Drosophila_2:1637568_at:716:439; Interrogation_Position=723; Antisense; GAGGCGCCACAGCACATCAATAAGC
>probe:Drosophila_2:1637568_at:175:439; Interrogation_Position=780; Antisense; GAGGAAGCTCTGAATGCCCAGCGGC
>probe:Drosophila_2:1637568_at:605:331; Interrogation_Position=800; Antisense; GCGGCAGATTCAGTCACAGTACGAT
>probe:Drosophila_2:1637568_at:79:527; Interrogation_Position=830; Antisense; GGGAGGAAGTTCGACCATCACCGAC
>probe:Drosophila_2:1637568_at:671:105; Interrogation_Position=958; Antisense; AGAACGGTGCCGGAAACTCTGGCGT
>probe:Drosophila_2:1637568_at:126:289; Interrogation_Position=983; Antisense; CGGTCCCATCGGCAATCATTATTTG

Paste this into a BLAST search page for me
TTATTTGCCCGCGAACCAGTTCTAAAAGTATTCTTCATTGCTCGTCACATTGCTCGTCACATCCAGATCTAGTTATTAGCTGTCATCAACACCACTTAGGAAGTGCTTGCCAATGTTACCCAAATACAATGTGCTGTTCGTCAAGACGCCTTGGCCAAGACCCTTAAGCAGGAGAAAGACCGTGGTCTATGTGCTGGCCAGAGGCGCCACAGCACATCAATAAGCGAGGAAGCTCTGAATGCCCAGCGGCGCGGCAGATTCAGTCACAGTACGATGGGAGGAAGTTCGACCATCACCGACAGAACGGTGCCGGAAACTCTGGCGTCGGTCCCATCGGCAATCATTATTTG

Full Affymetrix probeset data:

Annotations for 1637568_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720