Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637569_s_at:

>probe:Drosophila_2:1637569_s_at:257:279; Interrogation_Position=100; Antisense; CTGCTGAAGACCATCAAGAAGGTCT
>probe:Drosophila_2:1637569_s_at:626:371; Interrogation_Position=117; Antisense; GAAGGTCTTCAAGAACTCCAAGCCT
>probe:Drosophila_2:1637569_s_at:725:709; Interrogation_Position=124; Antisense; TTCAAGAACTCCAAGCCTTCGAAGG
>probe:Drosophila_2:1637569_s_at:513:203; Interrogation_Position=136; Antisense; AAGCCTTCGAAGGAGATTCCGATCC
>probe:Drosophila_2:1637569_s_at:183:77; Interrogation_Position=146; Antisense; AGGAGATTCCGATCCCCAACATCAT
>probe:Drosophila_2:1637569_s_at:419:189; Interrogation_Position=163; Antisense; AACATCATCTACTCTTGCAATACTG
>probe:Drosophila_2:1637569_s_at:355:275; Interrogation_Position=176; Antisense; CTTGCAATACTGAGGAGGAGCACCA
>probe:Drosophila_2:1637569_s_at:312:553; Interrogation_Position=192; Antisense; GGAGCACCAGAATTGGCTCAACGAA
>probe:Drosophila_2:1637569_s_at:683:195; Interrogation_Position=218; Antisense; AACTGGAGGCCATGGCAATCCATCT
>probe:Drosophila_2:1637569_s_at:435:391; Interrogation_Position=22; Antisense; GAAACCGCTCTTGTTTCCAACTTCA
>probe:Drosophila_2:1637569_s_at:480:579; Interrogation_Position=225; Antisense; GGCCATGGCAATCCATCTTCACTGA
>probe:Drosophila_2:1637569_s_at:648:337; Interrogation_Position=28; Antisense; GCTCTTGTTTCCAACTTCAATGGAG
>probe:Drosophila_2:1637569_s_at:136:311; Interrogation_Position=38; Antisense; CCAACTTCAATGGAGTGACAGAGAA
>probe:Drosophila_2:1637569_s_at:285:405; Interrogation_Position=58; Antisense; GAGAAGAAATCTCTTACCGGCGCCT

Paste this into a BLAST search page for me
CTGCTGAAGACCATCAAGAAGGTCTGAAGGTCTTCAAGAACTCCAAGCCTTTCAAGAACTCCAAGCCTTCGAAGGAAGCCTTCGAAGGAGATTCCGATCCAGGAGATTCCGATCCCCAACATCATAACATCATCTACTCTTGCAATACTGCTTGCAATACTGAGGAGGAGCACCAGGAGCACCAGAATTGGCTCAACGAAAACTGGAGGCCATGGCAATCCATCTGAAACCGCTCTTGTTTCCAACTTCAGGCCATGGCAATCCATCTTCACTGAGCTCTTGTTTCCAACTTCAATGGAGCCAACTTCAATGGAGTGACAGAGAAGAGAAGAAATCTCTTACCGGCGCCT

Full Affymetrix probeset data:

Annotations for 1637569_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime