FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637570_at:

>probe:Drosophila_2:1637570_at:322:125; Interrogation_Position=1572; Antisense; AGCCGTTGAGTATGTGCCACGCCTT
>probe:Drosophila_2:1637570_at:312:261; Interrogation_Position=1589; Antisense; CACGCCTTTGGTCTGACATGGTTGT
>probe:Drosophila_2:1637570_at:598:63; Interrogation_Position=1606; Antisense; ATGGTTGTGTTCGATCACACGCACC
>probe:Drosophila_2:1637570_at:328:145; Interrogation_Position=1644; Antisense; ACTCTACGTTCTTCGCATTTTGGTA
>probe:Drosophila_2:1637570_at:131:571; Interrogation_Position=1761; Antisense; GGCTATCAAGCGTCTCCGAAAGGTC
>probe:Drosophila_2:1637570_at:193:277; Interrogation_Position=1788; Antisense; CTTCACCGGCCAAATGCTGGGAGAT
>probe:Drosophila_2:1637570_at:613:527; Interrogation_Position=1806; Antisense; GGGAGATATACTCACGCTTCTCGTT
>probe:Drosophila_2:1637570_at:474:639; Interrogation_Position=1824; Antisense; TCTCGTTCGCGGTGGTAGCTACGAA
>probe:Drosophila_2:1637570_at:370:219; Interrogation_Position=1859; Antisense; AAGTCTTCGCCCACATTGACAAGAA
>probe:Drosophila_2:1637570_at:25:209; Interrogation_Position=1879; Antisense; AAGAACCAGCACAGAATTCCCGGAA
>probe:Drosophila_2:1637570_at:624:1; Interrogation_Position=1894; Antisense; ATTCCCGGAACACCAAGCCTAAATG
>probe:Drosophila_2:1637570_at:264:695; Interrogation_Position=1975; Antisense; TTTGCCCTGCAATATGCCGTTGAGA
>probe:Drosophila_2:1637570_at:109:389; Interrogation_Position=2056; Antisense; GAAACACACCTGTCTAAGCTGAAAT
>probe:Drosophila_2:1637570_at:596:337; Interrogation_Position=2082; Antisense; GCTCGTAGGCGAAAGTTTCCTCGAT

Paste this into a BLAST search page for me
AGCCGTTGAGTATGTGCCACGCCTTCACGCCTTTGGTCTGACATGGTTGTATGGTTGTGTTCGATCACACGCACCACTCTACGTTCTTCGCATTTTGGTAGGCTATCAAGCGTCTCCGAAAGGTCCTTCACCGGCCAAATGCTGGGAGATGGGAGATATACTCACGCTTCTCGTTTCTCGTTCGCGGTGGTAGCTACGAAAAGTCTTCGCCCACATTGACAAGAAAAGAACCAGCACAGAATTCCCGGAAATTCCCGGAACACCAAGCCTAAATGTTTGCCCTGCAATATGCCGTTGAGAGAAACACACCTGTCTAAGCTGAAATGCTCGTAGGCGAAAGTTTCCTCGAT

Full Affymetrix probeset data:

Annotations for 1637570_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720