FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637571_at:

>probe:Drosophila_2:1637571_at:564:383; Interrogation_Position=1019; Antisense; GAACTCACTATGTCTCTCAAGCTAA
>probe:Drosophila_2:1637571_at:711:481; Interrogation_Position=1047; Antisense; GTATAACTTCCACAACGACTGAGCC
>probe:Drosophila_2:1637571_at:78:407; Interrogation_Position=1063; Antisense; GACTGAGCCACAGAATGCTACTGAA
>probe:Drosophila_2:1637571_at:178:571; Interrogation_Position=1107; Antisense; GGCTTATTGATTTCGGCCACGAATT
>probe:Drosophila_2:1637571_at:151:663; Interrogation_Position=1144; Antisense; TAAAAGTTGACTGCCCTCAATGAGG
>probe:Drosophila_2:1637571_at:635:247; Interrogation_Position=1161; Antisense; CAATGAGGTGGCCAGTCATAACCCC
>probe:Drosophila_2:1637571_at:495:301; Interrogation_Position=1184; Antisense; CCCAGCCAGAAATTCAGGTGTTCAT
>probe:Drosophila_2:1637571_at:582:79; Interrogation_Position=1199; Antisense; AGGTGTTCATGCCATGTCCATGTCA
>probe:Drosophila_2:1637571_at:468:461; Interrogation_Position=1232; Antisense; GATTTTGCGCATTTTCTAGGAACCT
>probe:Drosophila_2:1637571_at:538:71; Interrogation_Position=1249; Antisense; AGGAACCTACGGCACTGAATGGAAG
>probe:Drosophila_2:1637571_at:577:417; Interrogation_Position=754; Antisense; GAGCTGTGAGCCAAATAATCCAAGT
>probe:Drosophila_2:1637571_at:278:277; Interrogation_Position=784; Antisense; CTAGGAATCCCTACCATATTGTAAT
>probe:Drosophila_2:1637571_at:398:485; Interrogation_Position=830; Antisense; GTAGTGCAGCTGTTGTCGATGCAAT
>probe:Drosophila_2:1637571_at:578:477; Interrogation_Position=971; Antisense; GTTTTACCACCTATAGAACAAAGCG

Paste this into a BLAST search page for me
GAACTCACTATGTCTCTCAAGCTAAGTATAACTTCCACAACGACTGAGCCGACTGAGCCACAGAATGCTACTGAAGGCTTATTGATTTCGGCCACGAATTTAAAAGTTGACTGCCCTCAATGAGGCAATGAGGTGGCCAGTCATAACCCCCCCAGCCAGAAATTCAGGTGTTCATAGGTGTTCATGCCATGTCCATGTCAGATTTTGCGCATTTTCTAGGAACCTAGGAACCTACGGCACTGAATGGAAGGAGCTGTGAGCCAAATAATCCAAGTCTAGGAATCCCTACCATATTGTAATGTAGTGCAGCTGTTGTCGATGCAATGTTTTACCACCTATAGAACAAAGCG

Full Affymetrix probeset data:

Annotations for 1637571_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720