Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637574_at:

>probe:Drosophila_2:1637574_at:482:129; Interrogation_Position=4440; Antisense; ACCAGTGCTGACATCGGAGGTTCCC
>probe:Drosophila_2:1637574_at:424:79; Interrogation_Position=4457; Antisense; AGGTTCCCGACTACCATCAGATCAT
>probe:Drosophila_2:1637574_at:346:181; Interrogation_Position=4483; Antisense; AAAACGCCCATGGATCTAGCTAAAA
>probe:Drosophila_2:1637574_at:572:233; Interrogation_Position=4511; Antisense; AATCCAAGCTAAACATGGGCGCCTA
>probe:Drosophila_2:1637574_at:375:523; Interrogation_Position=4527; Antisense; GGGCGCCTACCAGCTAAACGAGGAG
>probe:Drosophila_2:1637574_at:460:279; Interrogation_Position=4555; Antisense; CTCAGCGACATTCAGTTGGTGTTTA
>probe:Drosophila_2:1637574_at:668:685; Interrogation_Position=4616; Antisense; TATACGACGCTGGTTGTCAACTAGA
>probe:Drosophila_2:1637574_at:157:79; Interrogation_Position=4663; Antisense; AGGGACATGCAGCTACCGTTTAGGC
>probe:Drosophila_2:1637574_at:161:671; Interrogation_Position=4676; Antisense; TACCGTTTAGGCCTAGCGATATGAA
>probe:Drosophila_2:1637574_at:201:173; Interrogation_Position=4711; Antisense; AAAGCTTGCTGAGCCGGACGCTGAT
>probe:Drosophila_2:1637574_at:499:451; Interrogation_Position=4733; Antisense; GATCTCCACCAGCTATCGTGTAAAT
>probe:Drosophila_2:1637574_at:312:475; Interrogation_Position=4760; Antisense; GTTAGTCTACTCTAAGCCGTAGTTG
>probe:Drosophila_2:1637574_at:628:451; Interrogation_Position=4827; Antisense; GATCTTTATTTTCGTGCATGTCAGT
>probe:Drosophila_2:1637574_at:23:497; Interrogation_Position=4846; Antisense; GTCAGTTCTAAGTTCAGCACACGCA

Paste this into a BLAST search page for me
ACCAGTGCTGACATCGGAGGTTCCCAGGTTCCCGACTACCATCAGATCATAAAACGCCCATGGATCTAGCTAAAAAATCCAAGCTAAACATGGGCGCCTAGGGCGCCTACCAGCTAAACGAGGAGCTCAGCGACATTCAGTTGGTGTTTATATACGACGCTGGTTGTCAACTAGAAGGGACATGCAGCTACCGTTTAGGCTACCGTTTAGGCCTAGCGATATGAAAAAGCTTGCTGAGCCGGACGCTGATGATCTCCACCAGCTATCGTGTAAATGTTAGTCTACTCTAAGCCGTAGTTGGATCTTTATTTTCGTGCATGTCAGTGTCAGTTCTAAGTTCAGCACACGCA

Full Affymetrix probeset data:

Annotations for 1637574_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime