FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637575_at:

>probe:Drosophila_2:1637575_at:60:585; Interrogation_Position=1431; Antisense; TGGCATCTCGTATTTTCCTGGCCAT
>probe:Drosophila_2:1637575_at:385:597; Interrogation_Position=1464; Antisense; TGTGCATCCAGGTTCCTTCGAGATA
>probe:Drosophila_2:1637575_at:145:457; Interrogation_Position=1485; Antisense; GATACATTTATTTGGCCGGAGCCGT
>probe:Drosophila_2:1637575_at:521:477; Interrogation_Position=1508; Antisense; GTTTTCACCGTCTTTGCGAGATTCG
>probe:Drosophila_2:1637575_at:241:325; Interrogation_Position=1523; Antisense; GCGAGATTCGGTAGGCGAACCCTTC
>probe:Drosophila_2:1637575_at:284:91; Interrogation_Position=1619; Antisense; AGTTTGTGGGCATGGCCTGCATCAC
>probe:Drosophila_2:1637575_at:596:33; Interrogation_Position=1639; Antisense; ATCACGGCGGTCATTGGATTTCTGC
>probe:Drosophila_2:1637575_at:488:693; Interrogation_Position=1696; Antisense; TTTGCCGACTACTTGCCCAAGGAAA
>probe:Drosophila_2:1637575_at:177:225; Interrogation_Position=1713; Antisense; CAAGGAAAGGTTCGCCACTGGCTAT
>probe:Drosophila_2:1637575_at:608:225; Interrogation_Position=1757; Antisense; AAGGCAATGCCATGTTCCTCATCGG
>probe:Drosophila_2:1637575_at:591:667; Interrogation_Position=1819; Antisense; TACATTTTCGTCTTTCACATCCTAA
>probe:Drosophila_2:1637575_at:108:663; Interrogation_Position=1841; Antisense; TAAACGGCTTCATGATCCTGTGCGC
>probe:Drosophila_2:1637575_at:537:531; Interrogation_Position=1874; Antisense; GGGTCCTCGAAGTGCTGATCGTCAA
>probe:Drosophila_2:1637575_at:57:603; Interrogation_Position=1889; Antisense; TGATCGTCAAGTTTCGGAGGCGTAA

Paste this into a BLAST search page for me
TGGCATCTCGTATTTTCCTGGCCATTGTGCATCCAGGTTCCTTCGAGATAGATACATTTATTTGGCCGGAGCCGTGTTTTCACCGTCTTTGCGAGATTCGGCGAGATTCGGTAGGCGAACCCTTCAGTTTGTGGGCATGGCCTGCATCACATCACGGCGGTCATTGGATTTCTGCTTTGCCGACTACTTGCCCAAGGAAACAAGGAAAGGTTCGCCACTGGCTATAAGGCAATGCCATGTTCCTCATCGGTACATTTTCGTCTTTCACATCCTAATAAACGGCTTCATGATCCTGTGCGCGGGTCCTCGAAGTGCTGATCGTCAATGATCGTCAAGTTTCGGAGGCGTAA

Full Affymetrix probeset data:

Annotations for 1637575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720