Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637577_at:

>probe:Drosophila_2:1637577_at:284:461; Interrogation_Position=1421; Antisense; TGACCTTTGCGGTGGTTAGCCCTCT
>probe:Drosophila_2:1637577_at:211:213; Interrogation_Position=1481; Antisense; AAGAGACATCCGGACCCAGTCTGGT
>probe:Drosophila_2:1637577_at:626:11; Interrogation_Position=1513; Antisense; ATTCTGCAAGGATTCGCCTGCGGCA
>probe:Drosophila_2:1637577_at:254:623; Interrogation_Position=1531; Antisense; TGCGGCACGCTCATATACGTGGTGT
>probe:Drosophila_2:1637577_at:713:139; Interrogation_Position=1547; Antisense; ACGTGGTGTTCTTTGAGATACTCTC
>probe:Drosophila_2:1637577_at:446:621; Interrogation_Position=1570; Antisense; TCGAAAAATCGATCCGGTCTGCGCG
>probe:Drosophila_2:1637577_at:91:631; Interrogation_Position=1619; Antisense; TCCTTGTCATGTTTGGCCTGCAGCA
>probe:Drosophila_2:1637577_at:298:115; Interrogation_Position=1640; Antisense; AGCAGTTGACTTCCATTGGCGGACA
>probe:Drosophila_2:1637577_at:4:575; Interrogation_Position=1657; Antisense; GGCGGACATGGTCATAGCCACAGCC
>probe:Drosophila_2:1637577_at:600:113; Interrogation_Position=1684; Antisense; AGCAGTTGCTCCACGTCGGAACACA
>probe:Drosophila_2:1637577_at:654:607; Interrogation_Position=1734; Antisense; TGAGACCAGGTCAGCATCGGGCCAC
>probe:Drosophila_2:1637577_at:90:607; Interrogation_Position=1809; Antisense; TGAGGAGCTGGCCACGGTTCACAAC
>probe:Drosophila_2:1637577_at:181:613; Interrogation_Position=1836; Antisense; TGAACAGCAGCTGCAGCTCTTGCGG
>probe:Drosophila_2:1637577_at:617:371; Interrogation_Position=1896; Antisense; GAAGGACGCCTAGATTGTACCCTGC

Paste this into a BLAST search page for me
TGACCTTTGCGGTGGTTAGCCCTCTAAGAGACATCCGGACCCAGTCTGGTATTCTGCAAGGATTCGCCTGCGGCATGCGGCACGCTCATATACGTGGTGTACGTGGTGTTCTTTGAGATACTCTCTCGAAAAATCGATCCGGTCTGCGCGTCCTTGTCATGTTTGGCCTGCAGCAAGCAGTTGACTTCCATTGGCGGACAGGCGGACATGGTCATAGCCACAGCCAGCAGTTGCTCCACGTCGGAACACATGAGACCAGGTCAGCATCGGGCCACTGAGGAGCTGGCCACGGTTCACAACTGAACAGCAGCTGCAGCTCTTGCGGGAAGGACGCCTAGATTGTACCCTGC

Full Affymetrix probeset data:

Annotations for 1637577_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime