FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637578_at:

>probe:Drosophila_2:1637578_at:57:369; Interrogation_Position=1008; Antisense; GAAGGCCCACATTGTTTATAACCAC
>probe:Drosophila_2:1637578_at:705:563; Interrogation_Position=1034; Antisense; GGCAACTATAGTTTTCCCGATGGTT
>probe:Drosophila_2:1637578_at:341:477; Interrogation_Position=1044; Antisense; GTTTTCCCGATGGTTATGCAACATT
>probe:Drosophila_2:1637578_at:527:359; Interrogation_Position=1061; Antisense; GCAACATTTACATATTCGCAACGAT
>probe:Drosophila_2:1637578_at:302:615; Interrogation_Position=601; Antisense; TGAATTCAGCGGCTGCTTCCGAGAA
>probe:Drosophila_2:1637578_at:708:421; Interrogation_Position=621; Antisense; GAGAACGGAGACTGGCCCGCGTCTA
>probe:Drosophila_2:1637578_at:465:673; Interrogation_Position=644; Antisense; TACCAGCACGCCCATCAAATGGAAG
>probe:Drosophila_2:1637578_at:222:381; Interrogation_Position=677; Antisense; GAACCTGCTAAAACTTTTGCTGACA
>probe:Drosophila_2:1637578_at:510:375; Interrogation_Position=719; Antisense; GAAGAAGCGCAACTCCGAATACAAA
>probe:Drosophila_2:1637578_at:123:129; Interrogation_Position=744; Antisense; ACCTTCTTCGATTGGTTCTCGGATA
>probe:Drosophila_2:1637578_at:150:449; Interrogation_Position=774; Antisense; GATCCCGTCAACGACGAGATCGCAG
>probe:Drosophila_2:1637578_at:237:211; Interrogation_Position=808; Antisense; AAGACGACCTTTGGCCAAATCCACT
>probe:Drosophila_2:1637578_at:503:143; Interrogation_Position=830; Antisense; ACTGCAGTATTATCTGGTACCTGAT
>probe:Drosophila_2:1637578_at:366:15; Interrogation_Position=988; Antisense; ATTTCAAATCGCTCGCAACCGAAGG

Paste this into a BLAST search page for me
GAAGGCCCACATTGTTTATAACCACGGCAACTATAGTTTTCCCGATGGTTGTTTTCCCGATGGTTATGCAACATTGCAACATTTACATATTCGCAACGATTGAATTCAGCGGCTGCTTCCGAGAAGAGAACGGAGACTGGCCCGCGTCTATACCAGCACGCCCATCAAATGGAAGGAACCTGCTAAAACTTTTGCTGACAGAAGAAGCGCAACTCCGAATACAAAACCTTCTTCGATTGGTTCTCGGATAGATCCCGTCAACGACGAGATCGCAGAAGACGACCTTTGGCCAAATCCACTACTGCAGTATTATCTGGTACCTGATATTTCAAATCGCTCGCAACCGAAGG

Full Affymetrix probeset data:

Annotations for 1637578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720