Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637580_at:

>probe:Drosophila_2:1637580_at:193:453; Interrogation_Position=1013; Antisense; GATCTTCCATGTGGGCGGACACTGA
>probe:Drosophila_2:1637580_at:562:107; Interrogation_Position=1068; Antisense; AGAACAGGGCTCTAGCTATTCTCGG
>probe:Drosophila_2:1637580_at:445:115; Interrogation_Position=1081; Antisense; AGCTATTCTCGGCTCAGAACTTTAA
>probe:Drosophila_2:1637580_at:602:535; Interrogation_Position=1119; Antisense; GGTCCATAAGCCAAGCGATGCGGGA
>probe:Drosophila_2:1637580_at:253:187; Interrogation_Position=1151; Antisense; AACAACAAGTTCCAGATGCAGCCAA
>probe:Drosophila_2:1637580_at:234:137; Interrogation_Position=1201; Antisense; ACGAACTCACACATCGAATTCTCTT
>probe:Drosophila_2:1637580_at:496:363; Interrogation_Position=1216; Antisense; GAATTCTCTTTGAAGCCTGGAACTG
>probe:Drosophila_2:1637580_at:12:691; Interrogation_Position=1256; Antisense; TTTGATGACGACTTTCCCTAACGAA
>probe:Drosophila_2:1637580_at:18:609; Interrogation_Position=1372; Antisense; TGAGAGATACGTCTCCATTGGCCAA
>probe:Drosophila_2:1637580_at:238:23; Interrogation_Position=797; Antisense; ATATCACACCGGTGGACACGGAGTA
>probe:Drosophila_2:1637580_at:110:659; Interrogation_Position=849; Antisense; TAAGATGCGCAGGTCTGCTTCAGCC
>probe:Drosophila_2:1637580_at:66:465; Interrogation_Position=889; Antisense; GATTCCTCGAGCTTGTGGGCCAAAA
>probe:Drosophila_2:1637580_at:337:475; Interrogation_Position=931; Antisense; GTTAGCCTTGTTTCAACTCGGTCAA
>probe:Drosophila_2:1637580_at:404:227; Interrogation_Position=990; Antisense; AATGGATCGGAAGCTAGCCCGGCGA

Paste this into a BLAST search page for me
GATCTTCCATGTGGGCGGACACTGAAGAACAGGGCTCTAGCTATTCTCGGAGCTATTCTCGGCTCAGAACTTTAAGGTCCATAAGCCAAGCGATGCGGGAAACAACAAGTTCCAGATGCAGCCAAACGAACTCACACATCGAATTCTCTTGAATTCTCTTTGAAGCCTGGAACTGTTTGATGACGACTTTCCCTAACGAATGAGAGATACGTCTCCATTGGCCAAATATCACACCGGTGGACACGGAGTATAAGATGCGCAGGTCTGCTTCAGCCGATTCCTCGAGCTTGTGGGCCAAAAGTTAGCCTTGTTTCAACTCGGTCAAAATGGATCGGAAGCTAGCCCGGCGA

Full Affymetrix probeset data:

Annotations for 1637580_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime