Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637581_at:

>probe:Drosophila_2:1637581_at:523:379; Interrogation_Position=2561; Antisense; GAACCGGGCTATTCGACCGAGGACG
>probe:Drosophila_2:1637581_at:501:213; Interrogation_Position=2589; Antisense; AAGAGGGTCGCTATCATGCCTTCGA
>probe:Drosophila_2:1637581_at:672:49; Interrogation_Position=2604; Antisense; ATGCCTTCGATGACATACACCTGAT
>probe:Drosophila_2:1637581_at:717:159; Interrogation_Position=2655; Antisense; ACAACTCCGGCATGGGCATGTTCAA
>probe:Drosophila_2:1637581_at:321:119; Interrogation_Position=2705; Antisense; AGCTCGATTCTAGATGCCCATCAGG
>probe:Drosophila_2:1637581_at:259:715; Interrogation_Position=2732; Antisense; TTCCGCAACCTGGAGTTTACACTCA
>probe:Drosophila_2:1637581_at:131:667; Interrogation_Position=2749; Antisense; TACACTCAGCGATTATGGCGGCAGC
>probe:Drosophila_2:1637581_at:241:317; Interrogation_Position=2811; Antisense; GCCTGGATGGCGAACCCGTATACGA
>probe:Drosophila_2:1637581_at:276:253; Interrogation_Position=2851; Antisense; CAAGAAGTATCGCTGGAAGTCCACA
>probe:Drosophila_2:1637581_at:45:567; Interrogation_Position=2906; Antisense; GGCAAGGAGCCATCGCATCAGTGTC
>probe:Drosophila_2:1637581_at:189:389; Interrogation_Position=2950; Antisense; GAAACAGCGCGGCAATCTCGGTGTC
>probe:Drosophila_2:1637581_at:253:597; Interrogation_Position=2977; Antisense; TGTGAGGAAGCACCACACCGATCTG
>probe:Drosophila_2:1637581_at:103:63; Interrogation_Position=3068; Antisense; ATGTCCGATGACTCGCAGGGCAAGC
>probe:Drosophila_2:1637581_at:383:207; Interrogation_Position=3089; Antisense; AAGCTGATCATCGACTTCAATGGGA

Paste this into a BLAST search page for me
GAACCGGGCTATTCGACCGAGGACGAAGAGGGTCGCTATCATGCCTTCGAATGCCTTCGATGACATACACCTGATACAACTCCGGCATGGGCATGTTCAAAGCTCGATTCTAGATGCCCATCAGGTTCCGCAACCTGGAGTTTACACTCATACACTCAGCGATTATGGCGGCAGCGCCTGGATGGCGAACCCGTATACGACAAGAAGTATCGCTGGAAGTCCACAGGCAAGGAGCCATCGCATCAGTGTCGAAACAGCGCGGCAATCTCGGTGTCTGTGAGGAAGCACCACACCGATCTGATGTCCGATGACTCGCAGGGCAAGCAAGCTGATCATCGACTTCAATGGGA

Full Affymetrix probeset data:

Annotations for 1637581_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime