FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637583_at:

>probe:Drosophila_2:1637583_at:155:529; Interrogation_Position=305; Antisense; GGGAGCGGCCATTCACCTGTAACTT
>probe:Drosophila_2:1637583_at:109:493; Interrogation_Position=323; Antisense; GTAACTTCTGCAACAAGTCCTTCAC
>probe:Drosophila_2:1637583_at:359:643; Interrogation_Position=428; Antisense; TCTCCCAGCTGGTTAACCTCAAGAA
>probe:Drosophila_2:1637583_at:429:211; Interrogation_Position=448; Antisense; AAGAAACACAAGCTTGGCCACCTCA
>probe:Drosophila_2:1637583_at:529:311; Interrogation_Position=475; Antisense; GCCAAGCCCTACCAGTGTAATTACT
>probe:Drosophila_2:1637583_at:455:109; Interrogation_Position=503; Antisense; AGAAGGGCTTCACCCAGCTGTCAAA
>probe:Drosophila_2:1637583_at:20:491; Interrogation_Position=522; Antisense; GTCAAACTTTAAGCGCCACTTGCAG
>probe:Drosophila_2:1637583_at:661:533; Interrogation_Position=660; Antisense; GGTGTGTCGGGCCATCTTTGATACC
>probe:Drosophila_2:1637583_at:597:275; Interrogation_Position=675; Antisense; CTTTGATACCTTCGCTGACTATGAG
>probe:Drosophila_2:1637583_at:613:605; Interrogation_Position=720; Antisense; TGAGGACCACGAAAGGGCCCAGCTG
>probe:Drosophila_2:1637583_at:416:435; Interrogation_Position=745; Antisense; GAGGTTAACCAGATGTCCCACATGC
>probe:Drosophila_2:1637583_at:551:47; Interrogation_Position=770; Antisense; ATCCAGACGACTATTTGCCCATGAA
>probe:Drosophila_2:1637583_at:571:19; Interrogation_Position=782; Antisense; ATTTGCCCATGAAGTTTGCCGTGCC
>probe:Drosophila_2:1637583_at:721:625; Interrogation_Position=803; Antisense; TGCCCGATCTGGATACGCACGAAAT

Paste this into a BLAST search page for me
GGGAGCGGCCATTCACCTGTAACTTGTAACTTCTGCAACAAGTCCTTCACTCTCCCAGCTGGTTAACCTCAAGAAAAGAAACACAAGCTTGGCCACCTCAGCCAAGCCCTACCAGTGTAATTACTAGAAGGGCTTCACCCAGCTGTCAAAGTCAAACTTTAAGCGCCACTTGCAGGGTGTGTCGGGCCATCTTTGATACCCTTTGATACCTTCGCTGACTATGAGTGAGGACCACGAAAGGGCCCAGCTGGAGGTTAACCAGATGTCCCACATGCATCCAGACGACTATTTGCCCATGAAATTTGCCCATGAAGTTTGCCGTGCCTGCCCGATCTGGATACGCACGAAAT

Full Affymetrix probeset data:

Annotations for 1637583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720