Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637584_at:

>probe:Drosophila_2:1637584_at:511:507; Interrogation_Position=2305; Antisense; GTGCTCAGTATGGAATGCGACTTCA
>probe:Drosophila_2:1637584_at:223:647; Interrogation_Position=2391; Antisense; TCATGCCGGTGCCAGGACATTTAAT
>probe:Drosophila_2:1637584_at:578:697; Interrogation_Position=2410; Antisense; TTTAATCCAATAACCCTGCCAGCAA
>probe:Drosophila_2:1637584_at:254:311; Interrogation_Position=2427; Antisense; GCCAGCAACTTTTTAACGCAATGTG
>probe:Drosophila_2:1637584_at:540:611; Interrogation_Position=2501; Antisense; TGAACAGTAACCAACCCACAAGCAC
>probe:Drosophila_2:1637584_at:349:253; Interrogation_Position=2519; Antisense; CAAGCACACGAACTTCAGACACCTG
>probe:Drosophila_2:1637584_at:473:131; Interrogation_Position=2539; Antisense; ACCTGCAGTCCTGTTGTCTAACAAA
>probe:Drosophila_2:1637584_at:678:125; Interrogation_Position=2563; Antisense; AGCCTGATTTCACTGTCGCAATTTA
>probe:Drosophila_2:1637584_at:364:561; Interrogation_Position=2637; Antisense; GGAACCAGTCTTTACCAAACAATCG
>probe:Drosophila_2:1637584_at:588:259; Interrogation_Position=2664; Antisense; CACCGATACAGACCCACTTGAATTG
>probe:Drosophila_2:1637584_at:432:201; Interrogation_Position=2704; Antisense; AACCGAATGCGTGGGAGAGCTTTTC
>probe:Drosophila_2:1637584_at:721:259; Interrogation_Position=2735; Antisense; CACGCATTGCGACTCTATCAATCTA
>probe:Drosophila_2:1637584_at:386:679; Interrogation_Position=2767; Antisense; TAGTGGTATGCTATATCTACGTCAT
>probe:Drosophila_2:1637584_at:634:501; Interrogation_Position=2823; Antisense; TGTACTTACTAACCTCGACCTTAAT

Paste this into a BLAST search page for me
GTGCTCAGTATGGAATGCGACTTCATCATGCCGGTGCCAGGACATTTAATTTTAATCCAATAACCCTGCCAGCAAGCCAGCAACTTTTTAACGCAATGTGTGAACAGTAACCAACCCACAAGCACCAAGCACACGAACTTCAGACACCTGACCTGCAGTCCTGTTGTCTAACAAAAGCCTGATTTCACTGTCGCAATTTAGGAACCAGTCTTTACCAAACAATCGCACCGATACAGACCCACTTGAATTGAACCGAATGCGTGGGAGAGCTTTTCCACGCATTGCGACTCTATCAATCTATAGTGGTATGCTATATCTACGTCATTGTACTTACTAACCTCGACCTTAAT

Full Affymetrix probeset data:

Annotations for 1637584_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime