Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637587_at:

>probe:Drosophila_2:1637587_at:507:267; Interrogation_Position=2565; Antisense; CAGGGAATTGGTAAATATTCTCAAA
>probe:Drosophila_2:1637587_at:724:553; Interrogation_Position=2583; Antisense; TCTCAAAAATGTACGAAAACGGTCA
>probe:Drosophila_2:1637587_at:671:139; Interrogation_Position=2601; Antisense; ACGGTCACCTAACGAAGAACGATAT
>probe:Drosophila_2:1637587_at:634:537; Interrogation_Position=2603; Antisense; GGTCACCTAACGAAGAACGATATCA
>probe:Drosophila_2:1637587_at:170:383; Interrogation_Position=2617; Antisense; GAACGATATCAAATGCTTCCCGGAT
>probe:Drosophila_2:1637587_at:197:293; Interrogation_Position=2620; Antisense; CGATATCAAATGCTTCCCGGATCTA
>probe:Drosophila_2:1637587_at:317:457; Interrogation_Position=2621; Antisense; GATATCAAATGCTTCCCGGATCTAC
>probe:Drosophila_2:1637587_at:70:685; Interrogation_Position=2623; Antisense; TATCAAATGCTTCCCGGATCTACTT
>probe:Drosophila_2:1637587_at:520:167; Interrogation_Position=2627; Antisense; AAATGCTTCCCGGATCTACTTTATC
>probe:Drosophila_2:1637587_at:143:51; Interrogation_Position=2629; Antisense; ATGCTTCCCGGATCTACTTTATCAA
>probe:Drosophila_2:1637587_at:92:343; Interrogation_Position=2631; Antisense; GCTTCCCGGATCTACTTTATCAAAT
>probe:Drosophila_2:1637587_at:608:631; Interrogation_Position=2634; Antisense; TCCCGGATCTACTTTATCAAATACT
>probe:Drosophila_2:1637587_at:470:231; Interrogation_Position=2663; Antisense; AATGATTGCAAGGAAGCGAGTTCTC
>probe:Drosophila_2:1637587_at:2:465; Interrogation_Position=2666; Antisense; GATTGCAAGGAAGCGAGTTCTCGAT

Paste this into a BLAST search page for me
CAGGGAATTGGTAAATATTCTCAAATCTCAAAAATGTACGAAAACGGTCAACGGTCACCTAACGAAGAACGATATGGTCACCTAACGAAGAACGATATCAGAACGATATCAAATGCTTCCCGGATCGATATCAAATGCTTCCCGGATCTAGATATCAAATGCTTCCCGGATCTACTATCAAATGCTTCCCGGATCTACTTAAATGCTTCCCGGATCTACTTTATCATGCTTCCCGGATCTACTTTATCAAGCTTCCCGGATCTACTTTATCAAATTCCCGGATCTACTTTATCAAATACTAATGATTGCAAGGAAGCGAGTTCTCGATTGCAAGGAAGCGAGTTCTCGAT

Full Affymetrix probeset data:

Annotations for 1637587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime