FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637588_at:

>probe:Drosophila_2:1637588_at:433:243; Interrogation_Position=7283; Antisense; AATATACTAATGAACCACCTGCTGG
>probe:Drosophila_2:1637588_at:40:131; Interrogation_Position=7299; Antisense; ACCTGCTGGAATACGTGCTGGACTA
>probe:Drosophila_2:1637588_at:444:73; Interrogation_Position=7327; Antisense; AGGACATATACCAACTTATCCCAAG
>probe:Drosophila_2:1637588_at:573:401; Interrogation_Position=7360; Antisense; GACTATTCGCAATCTCCATTTTACT
>probe:Drosophila_2:1637588_at:411:249; Interrogation_Position=7369; Antisense; CAATCTCCATTTTACTTGCCTTTGG
>probe:Drosophila_2:1637588_at:148:541; Interrogation_Position=7392; Antisense; GGTTTATTCCATATCATTCCTTCAT
>probe:Drosophila_2:1637588_at:418:575; Interrogation_Position=7433; Antisense; GGCGAAAGTTTGGACCTCTAGGTTG
>probe:Drosophila_2:1637588_at:544:645; Interrogation_Position=7480; Antisense; TCATCCGACTGGTATGCAAGTTGTT
>probe:Drosophila_2:1637588_at:98:659; Interrogation_Position=7550; Antisense; TAAGCTGGGTGACTGTGCGTTACAT
>probe:Drosophila_2:1637588_at:368:505; Interrogation_Position=7585; Antisense; GTCCAATATGGAGGTCGCGTTACTG
>probe:Drosophila_2:1637588_at:295:635; Interrogation_Position=7599; Antisense; TCGCGTTACTGATGACTATGACAAA
>probe:Drosophila_2:1637588_at:24:51; Interrogation_Position=7650; Antisense; ATGGTTTCACGATACACTTTTCGAA
>probe:Drosophila_2:1637588_at:655:611; Interrogation_Position=7749; Antisense; TGACATGGCAAACGTAGACCCACCT
>probe:Drosophila_2:1637588_at:151:485; Interrogation_Position=7762; Antisense; GTAGACCCACCTCAAGTGTATGGAT

Paste this into a BLAST search page for me
AATATACTAATGAACCACCTGCTGGACCTGCTGGAATACGTGCTGGACTAAGGACATATACCAACTTATCCCAAGGACTATTCGCAATCTCCATTTTACTCAATCTCCATTTTACTTGCCTTTGGGGTTTATTCCATATCATTCCTTCATGGCGAAAGTTTGGACCTCTAGGTTGTCATCCGACTGGTATGCAAGTTGTTTAAGCTGGGTGACTGTGCGTTACATGTCCAATATGGAGGTCGCGTTACTGTCGCGTTACTGATGACTATGACAAAATGGTTTCACGATACACTTTTCGAATGACATGGCAAACGTAGACCCACCTGTAGACCCACCTCAAGTGTATGGAT

Full Affymetrix probeset data:

Annotations for 1637588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720