FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637590_at:

>probe:Drosophila_2:1637590_at:331:105; Interrogation_Position=1019; Antisense; AGACGAGTCTGCACTTTTCGGACTA
>probe:Drosophila_2:1637590_at:682:553; Interrogation_Position=1068; Antisense; GGACTTTGGCATTACCTTGTTTGTA
>probe:Drosophila_2:1637590_at:129:49; Interrogation_Position=1092; Antisense; ATCCATGTTCATGCACCTTTGTGTT
>probe:Drosophila_2:1637590_at:649:523; Interrogation_Position=1129; Antisense; GGGCGCCTCGAGATGGAACTGCTAA
>probe:Drosophila_2:1637590_at:184:89; Interrogation_Position=1221; Antisense; AGTAATTCCAGCGACTAGCATTTCC
>probe:Drosophila_2:1637590_at:428:543; Interrogation_Position=734; Antisense; GGATTCTGAGTCTTTCCATGCTGGC
>probe:Drosophila_2:1637590_at:700:493; Interrogation_Position=763; Antisense; GTAATCTTCGCCGTATATCCTTATA
>probe:Drosophila_2:1637590_at:19:403; Interrogation_Position=805; Antisense; GACATTTCCGCAATGGCTGGAGCTT
>probe:Drosophila_2:1637590_at:226:553; Interrogation_Position=823; Antisense; GGAGCTTTCTATCTTTGTTGCAGTC
>probe:Drosophila_2:1637590_at:50:691; Interrogation_Position=861; Antisense; TTTGGCCTTGTGCTGGATAATCTGG
>probe:Drosophila_2:1637590_at:277:53; Interrogation_Position=917; Antisense; ATGAGTTTCTGAGCTGGTCCTTTTG
>probe:Drosophila_2:1637590_at:69:173; Interrogation_Position=954; Antisense; AAAGTTGTCCTACTGCCTGTATATA
>probe:Drosophila_2:1637590_at:640:345; Interrogation_Position=981; Antisense; GCATCTGCTGGTGGAAACGGTTCAT
>probe:Drosophila_2:1637590_at:220:141; Interrogation_Position=997; Antisense; ACGGTTCATATAGCGCGGATCAAGA

Paste this into a BLAST search page for me
AGACGAGTCTGCACTTTTCGGACTAGGACTTTGGCATTACCTTGTTTGTAATCCATGTTCATGCACCTTTGTGTTGGGCGCCTCGAGATGGAACTGCTAAAGTAATTCCAGCGACTAGCATTTCCGGATTCTGAGTCTTTCCATGCTGGCGTAATCTTCGCCGTATATCCTTATAGACATTTCCGCAATGGCTGGAGCTTGGAGCTTTCTATCTTTGTTGCAGTCTTTGGCCTTGTGCTGGATAATCTGGATGAGTTTCTGAGCTGGTCCTTTTGAAAGTTGTCCTACTGCCTGTATATAGCATCTGCTGGTGGAAACGGTTCATACGGTTCATATAGCGCGGATCAAGA

Full Affymetrix probeset data:

Annotations for 1637590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720