Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637592_at:

>probe:Drosophila_2:1637592_at:678:343; Interrogation_Position=2180; Antisense; GCATTGCTGCGGACTGTGATACGGT
>probe:Drosophila_2:1637592_at:218:331; Interrogation_Position=2213; Antisense; GCGGATTTCCTCTATATGATCACCG
>probe:Drosophila_2:1637592_at:390:703; Interrogation_Position=2291; Antisense; TTACGCCATATGAGCCGAAACTTGA
>probe:Drosophila_2:1637592_at:477:239; Interrogation_Position=2344; Antisense; AATACACTGCGCATGAATTTCCAAT
>probe:Drosophila_2:1637592_at:383:239; Interrogation_Position=2366; Antisense; AATCAGCGACTACGGATCATGCCAG
>probe:Drosophila_2:1637592_at:509:35; Interrogation_Position=2381; Antisense; ATCATGCCAGTGTGTTTATCCAGCC
>probe:Drosophila_2:1637592_at:658:259; Interrogation_Position=2442; Antisense; CACGAGTTACATTGGCCAGCAGGAT
>probe:Drosophila_2:1637592_at:10:115; Interrogation_Position=2459; Antisense; AGCAGGATACCTCCCATATGTACTT
>probe:Drosophila_2:1637592_at:361:187; Interrogation_Position=2500; Antisense; AACACGGCATTGACTTTCTTTATTG
>probe:Drosophila_2:1637592_at:267:685; Interrogation_Position=2530; Antisense; TATAAACTGGATGCCGACTTTGCCG
>probe:Drosophila_2:1637592_at:447:481; Interrogation_Position=2554; Antisense; GTACCCTTGTGTCAGATCGGATTGG
>probe:Drosophila_2:1637592_at:548:541; Interrogation_Position=2572; Antisense; GGATTGGCTGTCCATTTTATTGGCA
>probe:Drosophila_2:1637592_at:727:373; Interrogation_Position=2631; Antisense; GAAGATACCATCATTTGCCGCTGCA
>probe:Drosophila_2:1637592_at:650:341; Interrogation_Position=2668; Antisense; GCTTCCTACCAACGTTACATTTTCT

Paste this into a BLAST search page for me
GCATTGCTGCGGACTGTGATACGGTGCGGATTTCCTCTATATGATCACCGTTACGCCATATGAGCCGAAACTTGAAATACACTGCGCATGAATTTCCAATAATCAGCGACTACGGATCATGCCAGATCATGCCAGTGTGTTTATCCAGCCCACGAGTTACATTGGCCAGCAGGATAGCAGGATACCTCCCATATGTACTTAACACGGCATTGACTTTCTTTATTGTATAAACTGGATGCCGACTTTGCCGGTACCCTTGTGTCAGATCGGATTGGGGATTGGCTGTCCATTTTATTGGCAGAAGATACCATCATTTGCCGCTGCAGCTTCCTACCAACGTTACATTTTCT

Full Affymetrix probeset data:

Annotations for 1637592_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime