FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637593_at:

>probe:Drosophila_2:1637593_at:214:711; Interrogation_Position=353; Antisense; TTAAGGATCACCATCGACCGCTGGA
>probe:Drosophila_2:1637593_at:201:417; Interrogation_Position=379; Antisense; GAGCGCGTTTACGAGTTCTGCAACA
>probe:Drosophila_2:1637593_at:347:1; Interrogation_Position=411; Antisense; ACAATGGCCCCGAGTTAGTAACAAG
>probe:Drosophila_2:1637593_at:695:215; Interrogation_Position=436; Antisense; AAGTTCTTCCGCTCGAGCCAGAATG
>probe:Drosophila_2:1637593_at:327:471; Interrogation_Position=487; Antisense; GTTCGAGGCTCCTTTGTGGCCAATG
>probe:Drosophila_2:1637593_at:620:229; Interrogation_Position=508; Antisense; AATGTGCGGTTCCACAAGATCACGC
>probe:Drosophila_2:1637593_at:334:359; Interrogation_Position=531; Antisense; GCAACCCTGTAACGTTTTGGTCCAG
>probe:Drosophila_2:1637593_at:496:399; Interrogation_Position=556; Antisense; GACACGGCCGCCATGTACAAGATGA
>probe:Drosophila_2:1637593_at:593:55; Interrogation_Position=577; Antisense; ATGACCAACTTTGGGCAGGCTCGCA
>probe:Drosophila_2:1637593_at:261:577; Interrogation_Position=675; Antisense; GGCCCAGCCGAAAGTCAACTACGAT
>probe:Drosophila_2:1637593_at:293:669; Interrogation_Position=694; Antisense; TACGATTGTCAATTGCCCAGCGATC
>probe:Drosophila_2:1637593_at:176:675; Interrogation_Position=722; Antisense; TAGAAATCGGTGGAGCCGCCGGTCT
>probe:Drosophila_2:1637593_at:320:419; Interrogation_Position=808; Antisense; GAGCAGGCCATCTTTTGCGGCGTGA
>probe:Drosophila_2:1637593_at:450:341; Interrogation_Position=860; Antisense; GCTATCAGAACCAGGCGGCCATTGT

Paste this into a BLAST search page for me
TTAAGGATCACCATCGACCGCTGGAGAGCGCGTTTACGAGTTCTGCAACAACAATGGCCCCGAGTTAGTAACAAGAAGTTCTTCCGCTCGAGCCAGAATGGTTCGAGGCTCCTTTGTGGCCAATGAATGTGCGGTTCCACAAGATCACGCGCAACCCTGTAACGTTTTGGTCCAGGACACGGCCGCCATGTACAAGATGAATGACCAACTTTGGGCAGGCTCGCAGGCCCAGCCGAAAGTCAACTACGATTACGATTGTCAATTGCCCAGCGATCTAGAAATCGGTGGAGCCGCCGGTCTGAGCAGGCCATCTTTTGCGGCGTGAGCTATCAGAACCAGGCGGCCATTGT

Full Affymetrix probeset data:

Annotations for 1637593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720