Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637594_at:

>probe:Drosophila_2:1637594_at:334:207; Interrogation_Position=103; Antisense; AAGCTGGAGGAAGGACATCCCGAAA
>probe:Drosophila_2:1637594_at:639:79; Interrogation_Position=160; Antisense; AGTGTCAGTGAGGATCAGCCGATCT
>probe:Drosophila_2:1637594_at:133:545; Interrogation_Position=171; Antisense; GGATCAGCCGATCTATGCGAATGTG
>probe:Drosophila_2:1637594_at:651:57; Interrogation_Position=19; Antisense; ATGAGTTTGAGAAGCTCGGCACGTT
>probe:Drosophila_2:1637594_at:718:555; Interrogation_Position=195; Antisense; GGACGAGGTTATACCGATCCATTTA
>probe:Drosophila_2:1637594_at:572:131; Interrogation_Position=229; Antisense; ACCGGAACCGAAGTCGATGCTCTAA
>probe:Drosophila_2:1637594_at:309:373; Interrogation_Position=238; Antisense; GAAGTCGATGCTCTAATGGGTAATG
>probe:Drosophila_2:1637594_at:215:493; Interrogation_Position=257; Antisense; GTAATGCACAGGTAAGCGGACCCAA
>probe:Drosophila_2:1637594_at:257:561; Interrogation_Position=289; Antisense; GGAACTCAGCTCCAGACCACCAGTT
>probe:Drosophila_2:1637594_at:595:377; Interrogation_Position=29; Antisense; GAAGCTCGGCACGTTATGCCAAGGC
>probe:Drosophila_2:1637594_at:153:619; Interrogation_Position=334; Antisense; TGCATCCCATCCAACAAAATACCGA
>probe:Drosophila_2:1637594_at:49:683; Interrogation_Position=43; Antisense; TATGCCAAGGCCAAATCCAAGTCGG
>probe:Drosophila_2:1637594_at:369:49; Interrogation_Position=57; Antisense; ATCCAAGTCGGCCATTAATCTCAAT
>probe:Drosophila_2:1637594_at:607:13; Interrogation_Position=70; Antisense; ATTAATCTCAATGCCCATCTGAAGA

Paste this into a BLAST search page for me
AAGCTGGAGGAAGGACATCCCGAAAAGTGTCAGTGAGGATCAGCCGATCTGGATCAGCCGATCTATGCGAATGTGATGAGTTTGAGAAGCTCGGCACGTTGGACGAGGTTATACCGATCCATTTAACCGGAACCGAAGTCGATGCTCTAAGAAGTCGATGCTCTAATGGGTAATGGTAATGCACAGGTAAGCGGACCCAAGGAACTCAGCTCCAGACCACCAGTTGAAGCTCGGCACGTTATGCCAAGGCTGCATCCCATCCAACAAAATACCGATATGCCAAGGCCAAATCCAAGTCGGATCCAAGTCGGCCATTAATCTCAATATTAATCTCAATGCCCATCTGAAGA

Full Affymetrix probeset data:

Annotations for 1637594_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime