Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637597_a_at:

>probe:Drosophila_2:1637597_a_at:592:97; Interrogation_Position=1017; Antisense; AGATCTCGAATTCATCCATCACACA
>probe:Drosophila_2:1637597_a_at:552:253; Interrogation_Position=1058; Antisense; CAAAAACCGAGGAGGCTGCCATGTT
>probe:Drosophila_2:1637597_a_at:428:461; Interrogation_Position=1080; Antisense; GTTGTTGGCCAAGAAATCCACCGAG
>probe:Drosophila_2:1637597_a_at:430:175; Interrogation_Position=610; Antisense; AAACTGAATCCGTCCTGGCAGGAAA
>probe:Drosophila_2:1637597_a_at:461:195; Interrogation_Position=633; Antisense; AACTGGCGTAGACATCGAAGACCGA
>probe:Drosophila_2:1637597_a_at:473:103; Interrogation_Position=651; Antisense; AGACCGATTCAGACAGGCGATGGAT
>probe:Drosophila_2:1637597_a_at:313:549; Interrogation_Position=708; Antisense; GGAGGTATCATGTTCCTGGATTCCA
>probe:Drosophila_2:1637597_a_at:408:291; Interrogation_Position=736; Antisense; CGGGATCACGTACGAGAGGCTCTTA
>probe:Drosophila_2:1637597_a_at:657:309; Interrogation_Position=782; Antisense; CCACCGGCGAGATTCTTGTGTTGAA
>probe:Drosophila_2:1637597_a_at:529:721; Interrogation_Position=802; Antisense; TTGAAGAATTTCTGCCCCTGGAAGT
>probe:Drosophila_2:1637597_a_at:434:563; Interrogation_Position=821; Antisense; GGAAGTCTCATCTGTTCGATCTTGA
>probe:Drosophila_2:1637597_a_at:85:591; Interrogation_Position=878; Antisense; TGGTCGTCTTCAACAGCGGCAATAG
>probe:Drosophila_2:1637597_a_at:186:585; Interrogation_Position=933; Antisense; TGGCAGCTATCTGGGCCGCAAATTT
>probe:Drosophila_2:1637597_a_at:642:629; Interrogation_Position=966; Antisense; TCCTTGGCGCGGACTGATGGACGAT

Paste this into a BLAST search page for me
AGATCTCGAATTCATCCATCACACACAAAAACCGAGGAGGCTGCCATGTTGTTGTTGGCCAAGAAATCCACCGAGAAACTGAATCCGTCCTGGCAGGAAAAACTGGCGTAGACATCGAAGACCGAAGACCGATTCAGACAGGCGATGGATGGAGGTATCATGTTCCTGGATTCCACGGGATCACGTACGAGAGGCTCTTACCACCGGCGAGATTCTTGTGTTGAATTGAAGAATTTCTGCCCCTGGAAGTGGAAGTCTCATCTGTTCGATCTTGATGGTCGTCTTCAACAGCGGCAATAGTGGCAGCTATCTGGGCCGCAAATTTTCCTTGGCGCGGACTGATGGACGAT

Full Affymetrix probeset data:

Annotations for 1637597_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime