FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637598_at:

>probe:Drosophila_2:1637598_at:675:159; Interrogation_Position=160; Antisense; ACAACGAGTTTTGCTCAAATTCGAA
>probe:Drosophila_2:1637598_at:615:651; Interrogation_Position=174; Antisense; TCAAATTCGAAGCTGCATCACCTGC
>probe:Drosophila_2:1637598_at:266:347; Interrogation_Position=188; Antisense; GCATCACCTGCATTTAGGACAGCCA
>probe:Drosophila_2:1637598_at:9:409; Interrogation_Position=407; Antisense; GACGTATAAACAGCACTTCGAGAAC
>probe:Drosophila_2:1637598_at:522:343; Interrogation_Position=434; Antisense; GCATCCCAAGAACGACATACCCGAG
>probe:Drosophila_2:1637598_at:335:547; Interrogation_Position=467; Antisense; GGAGGTCTGATGATCGTTTCACTTT
>probe:Drosophila_2:1637598_at:622:255; Interrogation_Position=486; Antisense; CACTTTAAGCTGAACGAGATGGACG
>probe:Drosophila_2:1637598_at:286:555; Interrogation_Position=506; Antisense; GGACGAGTTGCCTACCAGTACGAAA
>probe:Drosophila_2:1637598_at:462:29; Interrogation_Position=542; Antisense; ATAAATTTGCATCAGCCCTAAGAAG
>probe:Drosophila_2:1637598_at:689:211; Interrogation_Position=564; Antisense; AAGAAAGCCCACAATCAAGCCGAAG
>probe:Drosophila_2:1637598_at:538:233; Interrogation_Position=626; Antisense; AATGCCAGTTTTTTCGTATACACAC
>probe:Drosophila_2:1637598_at:541:289; Interrogation_Position=640; Antisense; CGTATACACACTGCTGAATTTTGGT
>probe:Drosophila_2:1637598_at:530:623; Interrogation_Position=695; Antisense; TGCGATTGTTCGATGTGTGGCTAAA
>probe:Drosophila_2:1637598_at:502:241; Interrogation_Position=721; Antisense; CAATACAAAGACACCTACCTACCTT

Paste this into a BLAST search page for me
ACAACGAGTTTTGCTCAAATTCGAATCAAATTCGAAGCTGCATCACCTGCGCATCACCTGCATTTAGGACAGCCAGACGTATAAACAGCACTTCGAGAACGCATCCCAAGAACGACATACCCGAGGGAGGTCTGATGATCGTTTCACTTTCACTTTAAGCTGAACGAGATGGACGGGACGAGTTGCCTACCAGTACGAAAATAAATTTGCATCAGCCCTAAGAAGAAGAAAGCCCACAATCAAGCCGAAGAATGCCAGTTTTTTCGTATACACACCGTATACACACTGCTGAATTTTGGTTGCGATTGTTCGATGTGTGGCTAAACAATACAAAGACACCTACCTACCTT

Full Affymetrix probeset data:

Annotations for 1637598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720