FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637600_at:

>probe:Drosophila_2:1637600_at:626:83; Interrogation_Position=217; Antisense; AGTGGCTGCACTCAAGTCAAGCGAA
>probe:Drosophila_2:1637600_at:353:529; Interrogation_Position=275; Antisense; GGGATCGCACCAGAATAACGCATCT
>probe:Drosophila_2:1637600_at:701:31; Interrogation_Position=289; Antisense; ATAACGCATCTCCAGGTGATCCATT
>probe:Drosophila_2:1637600_at:184:3; Interrogation_Position=311; Antisense; ATTCGCCTCCTACAACCAAAATATG
>probe:Drosophila_2:1637600_at:532:659; Interrogation_Position=356; Antisense; TAAGCCCAGTTACGGTCATTCTCAA
>probe:Drosophila_2:1637600_at:259:595; Interrogation_Position=406; Antisense; TGGGCTCAGAGCCTGGTCTTGAAAT
>probe:Drosophila_2:1637600_at:643:7; Interrogation_Position=448; Antisense; ATTCCATGCCCGAGTCTATGGGATT
>probe:Drosophila_2:1637600_at:472:609; Interrogation_Position=502; Antisense; TGAGCAATGGCCTTGGCGCTGGAAT
>probe:Drosophila_2:1637600_at:628:93; Interrogation_Position=530; Antisense; AGTTGGTTCCATGCGTGGTGGTCAA
>probe:Drosophila_2:1637600_at:612:71; Interrogation_Position=566; Antisense; AGGCTACTCTTCGAATGGTCTCAAT
>probe:Drosophila_2:1637600_at:113:65; Interrogation_Position=580; Antisense; ATGGTCTCAATGATCCGAACCCTTC
>probe:Drosophila_2:1637600_at:150:45; Interrogation_Position=608; Antisense; ATCCCACCGTGGTAGTTGGTTCTAG
>probe:Drosophila_2:1637600_at:270:677; Interrogation_Position=630; Antisense; TAGAAGAGCCCATTAGTTCCTAACT
>probe:Drosophila_2:1637600_at:126:191; Interrogation_Position=655; Antisense; AACTTTACGAATCTCATTTGGCACT

Paste this into a BLAST search page for me
AGTGGCTGCACTCAAGTCAAGCGAAGGGATCGCACCAGAATAACGCATCTATAACGCATCTCCAGGTGATCCATTATTCGCCTCCTACAACCAAAATATGTAAGCCCAGTTACGGTCATTCTCAATGGGCTCAGAGCCTGGTCTTGAAATATTCCATGCCCGAGTCTATGGGATTTGAGCAATGGCCTTGGCGCTGGAATAGTTGGTTCCATGCGTGGTGGTCAAAGGCTACTCTTCGAATGGTCTCAATATGGTCTCAATGATCCGAACCCTTCATCCCACCGTGGTAGTTGGTTCTAGTAGAAGAGCCCATTAGTTCCTAACTAACTTTACGAATCTCATTTGGCACT

Full Affymetrix probeset data:

Annotations for 1637600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720