Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637601_at:

>probe:Drosophila_2:1637601_at:214:409; Interrogation_Position=1691; Antisense; GACGCAACTTATACCGAACTCTCAG
>probe:Drosophila_2:1637601_at:269:193; Interrogation_Position=1740; Antisense; AACGAACCGTCGCACTGGAAGGCTC
>probe:Drosophila_2:1637601_at:120:585; Interrogation_Position=1755; Antisense; TGGAAGGCTCAGCTTTTTGTCACGC
>probe:Drosophila_2:1637601_at:577:597; Interrogation_Position=1772; Antisense; TGTCACGCCTAGCAAACTGATTCTG
>probe:Drosophila_2:1637601_at:144:143; Interrogation_Position=1787; Antisense; ACTGATTCTGATGAGCGTCGTGGCG
>probe:Drosophila_2:1637601_at:74:131; Interrogation_Position=1821; Antisense; ACCTGCCTGGTTATCGTCTTTATCA
>probe:Drosophila_2:1637601_at:126:639; Interrogation_Position=1834; Antisense; TCGTCTTTATCATCCTTGTGCTATA
>probe:Drosophila_2:1637601_at:30:383; Interrogation_Position=1887; Antisense; GAACGCTTGCAGGAGTCTCACAGAT
>probe:Drosophila_2:1637601_at:482:431; Interrogation_Position=1899; Antisense; GAGTCTCACAGATTCCATTTCGATG
>probe:Drosophila_2:1637601_at:584:53; Interrogation_Position=1921; Antisense; ATGCAATGTAAGGTGGTCGCCCCAT
>probe:Drosophila_2:1637601_at:140:531; Interrogation_Position=1932; Antisense; GGTGGTCGCCCCATTAAATGTAAAT
>probe:Drosophila_2:1637601_at:282:417; Interrogation_Position=2044; Antisense; GAGCGCTCTATTAACTCCATTATAA
>probe:Drosophila_2:1637601_at:571:115; Interrogation_Position=2068; Antisense; AGCTTTCCAACCATATTGATGTCCT
>probe:Drosophila_2:1637601_at:269:555; Interrogation_Position=2143; Antisense; GGACCATCTCAAGGCGGCTTTTAAA

Paste this into a BLAST search page for me
GACGCAACTTATACCGAACTCTCAGAACGAACCGTCGCACTGGAAGGCTCTGGAAGGCTCAGCTTTTTGTCACGCTGTCACGCCTAGCAAACTGATTCTGACTGATTCTGATGAGCGTCGTGGCGACCTGCCTGGTTATCGTCTTTATCATCGTCTTTATCATCCTTGTGCTATAGAACGCTTGCAGGAGTCTCACAGATGAGTCTCACAGATTCCATTTCGATGATGCAATGTAAGGTGGTCGCCCCATGGTGGTCGCCCCATTAAATGTAAATGAGCGCTCTATTAACTCCATTATAAAGCTTTCCAACCATATTGATGTCCTGGACCATCTCAAGGCGGCTTTTAAA

Full Affymetrix probeset data:

Annotations for 1637601_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime