Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637602_at:

>probe:Drosophila_2:1637602_at:43:217; Interrogation_Position=3688; Antisense; AAGTTCGGCGTCGATGCGCGCATGA
>probe:Drosophila_2:1637602_at:511:323; Interrogation_Position=3703; Antisense; GCGCGCATGACAATGAGCGACTCAA
>probe:Drosophila_2:1637602_at:227:307; Interrogation_Position=3829; Antisense; CCATCACCTCTAACGGTTTTCTGAT
>probe:Drosophila_2:1637602_at:122:541; Interrogation_Position=3843; Antisense; GGTTTTCTGATATGTTGCCGATCAT
>probe:Drosophila_2:1637602_at:130:319; Interrogation_Position=3859; Antisense; GCCGATCATGATATTTGCAGTGCTG
>probe:Drosophila_2:1637602_at:55:351; Interrogation_Position=3875; Antisense; GCAGTGCTGTACTTTGTACTTTTCT
>probe:Drosophila_2:1637602_at:306:613; Interrogation_Position=3946; Antisense; TGCAATTACCAAACCATTTCCAGGA
>probe:Drosophila_2:1637602_at:569:725; Interrogation_Position=3982; Antisense; TTGTACAATCATGTTTACCAGCGAT
>probe:Drosophila_2:1637602_at:507:655; Interrogation_Position=4070; Antisense; TAAGTGGTCCTACTTGTGCCGACAA
>probe:Drosophila_2:1637602_at:135:707; Interrogation_Position=4104; Antisense; TTAGCATATGAACCCGCAACTCTTG
>probe:Drosophila_2:1637602_at:24:435; Interrogation_Position=4128; Antisense; GAGGTTTTCTCAATACCTTACCAAG
>probe:Drosophila_2:1637602_at:280:657; Interrogation_Position=4180; Antisense; TAATGGTTCGAGTGCTTGTGTGCGT
>probe:Drosophila_2:1637602_at:684:507; Interrogation_Position=4199; Antisense; GTGCGTGTAAACTATTTGCGATGAC
>probe:Drosophila_2:1637602_at:624:721; Interrogation_Position=4214; Antisense; TTGCGATGACTGTTGTTGGCTGTAT

Paste this into a BLAST search page for me
AAGTTCGGCGTCGATGCGCGCATGAGCGCGCATGACAATGAGCGACTCAACCATCACCTCTAACGGTTTTCTGATGGTTTTCTGATATGTTGCCGATCATGCCGATCATGATATTTGCAGTGCTGGCAGTGCTGTACTTTGTACTTTTCTTGCAATTACCAAACCATTTCCAGGATTGTACAATCATGTTTACCAGCGATTAAGTGGTCCTACTTGTGCCGACAATTAGCATATGAACCCGCAACTCTTGGAGGTTTTCTCAATACCTTACCAAGTAATGGTTCGAGTGCTTGTGTGCGTGTGCGTGTAAACTATTTGCGATGACTTGCGATGACTGTTGTTGGCTGTAT

Full Affymetrix probeset data:

Annotations for 1637602_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime