FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637606_at:

>probe:Drosophila_2:1637606_at:375:459; Interrogation_Position=196; Antisense; GATTTTCTGCCCGTTAAGTGCGACT
>probe:Drosophila_2:1637606_at:50:221; Interrogation_Position=211; Antisense; AAGTGCGACTCGTGCGACAAGGTCT
>probe:Drosophila_2:1637606_at:372:107; Interrogation_Position=287; Antisense; AGAAGAACGTTCAGGTGCCCGTCTG
>probe:Drosophila_2:1637606_at:90:417; Interrogation_Position=352; Antisense; GAGCCCGATGTCACTGTTGGCCAGC
>probe:Drosophila_2:1637606_at:205:467; Interrogation_Position=367; Antisense; GTTGGCCAGCACATTGACCAGCAGT
>probe:Drosophila_2:1637606_at:321:375; Interrogation_Position=408; Antisense; GAAGATCTACACCAATCGCTGCAAT
>probe:Drosophila_2:1637606_at:670:75; Interrogation_Position=446; Antisense; AGCGAAAGGAGCTCATCCCGGTGAC
>probe:Drosophila_2:1637606_at:368:621; Interrogation_Position=472; Antisense; TGCTCGCAGTGTCGCTTGAACTTTT
>probe:Drosophila_2:1637606_at:449:721; Interrogation_Position=487; Antisense; TTGAACTTTTGCCTGCGTCATCGAC
>probe:Drosophila_2:1637606_at:522:87; Interrogation_Position=578; Antisense; AGTCCATATTCAAGACCTCCTCGGA
>probe:Drosophila_2:1637606_at:265:371; Interrogation_Position=647; Antisense; GAAGGCCCGCGAGCAATAGCATCAG
>probe:Drosophila_2:1637606_at:110:347; Interrogation_Position=665; Antisense; GCATCAGCAATACCAATTCCAGACC
>probe:Drosophila_2:1637606_at:544:247; Interrogation_Position=679; Antisense; AATTCCAGACCTCGACCTGTGCAGG
>probe:Drosophila_2:1637606_at:615:427; Interrogation_Position=738; Antisense; GAGTTGGCAAGCTGGTCTCAACTAA

Paste this into a BLAST search page for me
GATTTTCTGCCCGTTAAGTGCGACTAAGTGCGACTCGTGCGACAAGGTCTAGAAGAACGTTCAGGTGCCCGTCTGGAGCCCGATGTCACTGTTGGCCAGCGTTGGCCAGCACATTGACCAGCAGTGAAGATCTACACCAATCGCTGCAATAGCGAAAGGAGCTCATCCCGGTGACTGCTCGCAGTGTCGCTTGAACTTTTTTGAACTTTTGCCTGCGTCATCGACAGTCCATATTCAAGACCTCCTCGGAGAAGGCCCGCGAGCAATAGCATCAGGCATCAGCAATACCAATTCCAGACCAATTCCAGACCTCGACCTGTGCAGGGAGTTGGCAAGCTGGTCTCAACTAA

Full Affymetrix probeset data:

Annotations for 1637606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720