Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637607_at:

>probe:Drosophila_2:1637607_at:68:25; Interrogation_Position=2017; Antisense; ATATGGAGTGAGTCTGCTGCTTGTG
>probe:Drosophila_2:1637607_at:183:729; Interrogation_Position=2037; Antisense; TTGTGGTCTGTCTGCTGCGATTCAT
>probe:Drosophila_2:1637607_at:399:463; Interrogation_Position=2055; Antisense; GATTCATGTGCCACCACAAGGCGAA
>probe:Drosophila_2:1637607_at:689:509; Interrogation_Position=2096; Antisense; GTGCAGCGCTTGTAGGATCGATTTC
>probe:Drosophila_2:1637607_at:332:451; Interrogation_Position=2111; Antisense; GATCGATTTCGTGAAGTTCTCTCCC
>probe:Drosophila_2:1637607_at:180:715; Interrogation_Position=2127; Antisense; TTCTCTCCCTTCTGCAATGTTGTGA
>probe:Drosophila_2:1637607_at:206:249; Interrogation_Position=2173; Antisense; AATTGGCCATTTCTGCAAGCGATCA
>probe:Drosophila_2:1637607_at:317:89; Interrogation_Position=2199; Antisense; AGTCAAATCTAGTTGTAGGCCATGT
>probe:Drosophila_2:1637607_at:19:695; Interrogation_Position=2235; Antisense; TTTCTAGTTCTTTAGGTGCATGCTA
>probe:Drosophila_2:1637607_at:674:507; Interrogation_Position=2250; Antisense; GTGCATGCTAGAGGCTACGTTTAGA
>probe:Drosophila_2:1637607_at:722:727; Interrogation_Position=2320; Antisense; TTGTGGTCCAGCTTTTGCAGTCGAC
>probe:Drosophila_2:1637607_at:57:351; Interrogation_Position=2336; Antisense; GCAGTCGACCTGTTTTGTGTTCAGT
>probe:Drosophila_2:1637607_at:220:459; Interrogation_Position=2412; Antisense; GATATTTGCTCACCTTAAAAGTACT
>probe:Drosophila_2:1637607_at:300:65; Interrogation_Position=2521; Antisense; ATGGAGTACGCCTTAAATGATATTT

Paste this into a BLAST search page for me
ATATGGAGTGAGTCTGCTGCTTGTGTTGTGGTCTGTCTGCTGCGATTCATGATTCATGTGCCACCACAAGGCGAAGTGCAGCGCTTGTAGGATCGATTTCGATCGATTTCGTGAAGTTCTCTCCCTTCTCTCCCTTCTGCAATGTTGTGAAATTGGCCATTTCTGCAAGCGATCAAGTCAAATCTAGTTGTAGGCCATGTTTTCTAGTTCTTTAGGTGCATGCTAGTGCATGCTAGAGGCTACGTTTAGATTGTGGTCCAGCTTTTGCAGTCGACGCAGTCGACCTGTTTTGTGTTCAGTGATATTTGCTCACCTTAAAAGTACTATGGAGTACGCCTTAAATGATATTT

Full Affymetrix probeset data:

Annotations for 1637607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime