Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637608_at:

>probe:Drosophila_2:1637608_at:155:461; Interrogation_Position=550; Antisense; GATTATATCACGAGGCTACTGGACA
>probe:Drosophila_2:1637608_at:278:371; Interrogation_Position=600; Antisense; GAAGGCATTGGTTCAGGCCACCTAC
>probe:Drosophila_2:1637608_at:484:583; Interrogation_Position=625; Antisense; TGGCACGACCCGATCATGGAGAACA
>probe:Drosophila_2:1637608_at:184:67; Interrogation_Position=640; Antisense; ATGGAGAACAAATACCGCCTGGGCA
>probe:Drosophila_2:1637608_at:456:351; Interrogation_Position=662; Antisense; GCAGCACATTTCTCGCGGACATTAA
>probe:Drosophila_2:1637608_at:127:331; Interrogation_Position=676; Antisense; GCGGACATTAACAACGAGCTCTTCA
>probe:Drosophila_2:1637608_at:174:513; Interrogation_Position=745; Antisense; GTGATGGTGCAGTTCCTAAACGACA
>probe:Drosophila_2:1637608_at:312:245; Interrogation_Position=771; Antisense; AATTGTCCAGCCGAAGGAGTCCCAG
>probe:Drosophila_2:1637608_at:609:477; Interrogation_Position=798; Antisense; GTTTCAATACTACACCACTGGGCAG
>probe:Drosophila_2:1637608_at:712:647; Interrogation_Position=830; Antisense; TCATCCAGCCCTTTACTGAGAGCAA
>probe:Drosophila_2:1637608_at:641:225; Interrogation_Position=893; Antisense; AAGGACAACTTGTCTTTCTCGGCGT
>probe:Drosophila_2:1637608_at:114:373; Interrogation_Position=919; Antisense; GAAGGTGATCACTTGGCCATATCCA
>probe:Drosophila_2:1637608_at:155:591; Interrogation_Position=949; Antisense; TGGTTTATCCAGAACATAGTGCCTC
>probe:Drosophila_2:1637608_at:437:25; Interrogation_Position=964; Antisense; ATAGTGCCTCTCTTACTCGAAAAAT

Paste this into a BLAST search page for me
GATTATATCACGAGGCTACTGGACAGAAGGCATTGGTTCAGGCCACCTACTGGCACGACCCGATCATGGAGAACAATGGAGAACAAATACCGCCTGGGCAGCAGCACATTTCTCGCGGACATTAAGCGGACATTAACAACGAGCTCTTCAGTGATGGTGCAGTTCCTAAACGACAAATTGTCCAGCCGAAGGAGTCCCAGGTTTCAATACTACACCACTGGGCAGTCATCCAGCCCTTTACTGAGAGCAAAAGGACAACTTGTCTTTCTCGGCGTGAAGGTGATCACTTGGCCATATCCATGGTTTATCCAGAACATAGTGCCTCATAGTGCCTCTCTTACTCGAAAAAT

Full Affymetrix probeset data:

Annotations for 1637608_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime