FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637610_at:

>probe:Drosophila_2:1637610_at:54:651; Interrogation_Position=160; Antisense; TCAGCCGCGTGCGAACGATCATGAA
>probe:Drosophila_2:1637610_at:91:615; Interrogation_Position=181; Antisense; TGAAGAGCTCCATGGACACGGGCTT
>probe:Drosophila_2:1637610_at:399:157; Interrogation_Position=196; Antisense; ACACGGGCTTGATCACCAACGAGGT
>probe:Drosophila_2:1637610_at:536:435; Interrogation_Position=216; Antisense; GAGGTGCTCTTCCTGATGACCAAGT
>probe:Drosophila_2:1637610_at:86:221; Interrogation_Position=237; Antisense; AAGTGCACGGAGCTATTCGTTCGCC
>probe:Drosophila_2:1637610_at:343:665; Interrogation_Position=279; Antisense; TACACGGAGGAATTCGGCCAGCGAC
>probe:Drosophila_2:1637610_at:653:217; Interrogation_Position=318; Antisense; AAGTACGAGCATCTCTCCCAGGTGG
>probe:Drosophila_2:1637610_at:669:715; Interrogation_Position=367; Antisense; TTCTGCTGCAGATCGTGCCGCAAAA
>probe:Drosophila_2:1637610_at:149:173; Interrogation_Position=389; Antisense; AAAGATCCGTGTACACCAGTTCCAG
>probe:Drosophila_2:1637610_at:674:265; Interrogation_Position=405; Antisense; CAGTTCCAGGAGATGCTGCGGCTAA
>probe:Drosophila_2:1637610_at:265:433; Interrogation_Position=552; Antisense; GAGTGGATGATCTCCATTCACCAAA
>probe:Drosophila_2:1637610_at:574:35; Interrogation_Position=579; Antisense; ATCGACTGATTTTTTACGCCACCTT
>probe:Drosophila_2:1637610_at:302:299; Interrogation_Position=595; Antisense; CGCCACCTTGCTATCTTTAATTTTA
>probe:Drosophila_2:1637610_at:321:377; Interrogation_Position=668; Antisense; GAAGCATAAGAGCACTGCGTCCTCC

Paste this into a BLAST search page for me
TCAGCCGCGTGCGAACGATCATGAATGAAGAGCTCCATGGACACGGGCTTACACGGGCTTGATCACCAACGAGGTGAGGTGCTCTTCCTGATGACCAAGTAAGTGCACGGAGCTATTCGTTCGCCTACACGGAGGAATTCGGCCAGCGACAAGTACGAGCATCTCTCCCAGGTGGTTCTGCTGCAGATCGTGCCGCAAAAAAAGATCCGTGTACACCAGTTCCAGCAGTTCCAGGAGATGCTGCGGCTAAGAGTGGATGATCTCCATTCACCAAAATCGACTGATTTTTTACGCCACCTTCGCCACCTTGCTATCTTTAATTTTAGAAGCATAAGAGCACTGCGTCCTCC

Full Affymetrix probeset data:

Annotations for 1637610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720