Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637611_at:

>probe:Drosophila_2:1637611_at:529:441; Interrogation_Position=1009; Antisense; GATGGGCTGCTACTCAGCTGGAACA
>probe:Drosophila_2:1637611_at:48:445; Interrogation_Position=1045; Antisense; GATGATCCACACTTGTCTTTTTCAA
>probe:Drosophila_2:1637611_at:211:453; Interrogation_Position=1074; Antisense; GATCTCTAGGCCGTAATCAATCAGC
>probe:Drosophila_2:1637611_at:335:589; Interrogation_Position=573; Antisense; TGGATGTACGAGTTCGCCACCGAAG
>probe:Drosophila_2:1637611_at:397:287; Interrogation_Position=630; Antisense; CTGGAGTACGCCCTGATCACAGAGG
>probe:Drosophila_2:1637611_at:518:649; Interrogation_Position=646; Antisense; TCACAGAGGCAGAGGGCTTTCCGTC
>probe:Drosophila_2:1637611_at:729:311; Interrogation_Position=678; Antisense; GCCACCACGAGTCATTGAGCCGATT
>probe:Drosophila_2:1637611_at:319:525; Interrogation_Position=722; Antisense; GGGAACCACGCATTGGCGAACCTTG
>probe:Drosophila_2:1637611_at:541:323; Interrogation_Position=737; Antisense; GCGAACCTTGTGTAGCCCTAAGTAT
>probe:Drosophila_2:1637611_at:4:269; Interrogation_Position=776; Antisense; CAGGCGATGGCCTCTATGCATTAGA
>probe:Drosophila_2:1637611_at:212:459; Interrogation_Position=853; Antisense; GATATATCGGTTGCACATCCGCCAC
>probe:Drosophila_2:1637611_at:497:665; Interrogation_Position=892; Antisense; TACGGCCCTGTCTTAACGTGACTTA
>probe:Drosophila_2:1637611_at:662:483; Interrogation_Position=926; Antisense; GTAGGCACATCTAGCACGTAAGCAG
>probe:Drosophila_2:1637611_at:471:575; Interrogation_Position=955; Antisense; GGCGCCCAATTCTACCATTTAAATG

Paste this into a BLAST search page for me
GATGGGCTGCTACTCAGCTGGAACAGATGATCCACACTTGTCTTTTTCAAGATCTCTAGGCCGTAATCAATCAGCTGGATGTACGAGTTCGCCACCGAAGCTGGAGTACGCCCTGATCACAGAGGTCACAGAGGCAGAGGGCTTTCCGTCGCCACCACGAGTCATTGAGCCGATTGGGAACCACGCATTGGCGAACCTTGGCGAACCTTGTGTAGCCCTAAGTATCAGGCGATGGCCTCTATGCATTAGAGATATATCGGTTGCACATCCGCCACTACGGCCCTGTCTTAACGTGACTTAGTAGGCACATCTAGCACGTAAGCAGGGCGCCCAATTCTACCATTTAAATG

Full Affymetrix probeset data:

Annotations for 1637611_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime