Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637612_at:

>probe:Drosophila_2:1637612_at:662:377; Interrogation_Position=2530; Antisense; GAAGCGTCATCGCTGACCGATATCG
>probe:Drosophila_2:1637612_at:467:581; Interrogation_Position=2584; Antisense; TGGCTACCCTTCACTAACGTACATA
>probe:Drosophila_2:1637612_at:642:145; Interrogation_Position=2631; Antisense; ACTCTGTATATTTCTGCGTATTTCT
>probe:Drosophila_2:1637612_at:108:329; Interrogation_Position=2646; Antisense; GCGTATTTCTTACTCTTCGATCATA
>probe:Drosophila_2:1637612_at:168:201; Interrogation_Position=2783; Antisense; AACCAGAGTTTGTTTAAGCGTGCAA
>probe:Drosophila_2:1637612_at:57:207; Interrogation_Position=2798; Antisense; AAGCGTGCAATATTCAAGATTCTAA
>probe:Drosophila_2:1637612_at:595:215; Interrogation_Position=2813; Antisense; AAGATTCTAATTCACCTACTGAGAT
>probe:Drosophila_2:1637612_at:118:597; Interrogation_Position=2920; Antisense; TGTGGGTTCTGAGCGAAGTTCGTCC
>probe:Drosophila_2:1637612_at:206:631; Interrogation_Position=2942; Antisense; TCCTAGGCGGGCTGCTCATTGGAGC
>probe:Drosophila_2:1637612_at:161:337; Interrogation_Position=2955; Antisense; GCTCATTGGAGCCTTATCTTATGGA
>probe:Drosophila_2:1637612_at:650:245; Interrogation_Position=2998; Antisense; AATTCAGGACTACGCAACCTTCACA
>probe:Drosophila_2:1637612_at:101:401; Interrogation_Position=3026; Antisense; GACAGCTCTCTAGGATCGACTACTT
>probe:Drosophila_2:1637612_at:686:401; Interrogation_Position=3043; Antisense; GACTACTTCGCTTCGGGAACGGCAC
>probe:Drosophila_2:1637612_at:181:563; Interrogation_Position=3058; Antisense; GGAACGGCACGCAAAGACTTTTCAA

Paste this into a BLAST search page for me
GAAGCGTCATCGCTGACCGATATCGTGGCTACCCTTCACTAACGTACATAACTCTGTATATTTCTGCGTATTTCTGCGTATTTCTTACTCTTCGATCATAAACCAGAGTTTGTTTAAGCGTGCAAAAGCGTGCAATATTCAAGATTCTAAAAGATTCTAATTCACCTACTGAGATTGTGGGTTCTGAGCGAAGTTCGTCCTCCTAGGCGGGCTGCTCATTGGAGCGCTCATTGGAGCCTTATCTTATGGAAATTCAGGACTACGCAACCTTCACAGACAGCTCTCTAGGATCGACTACTTGACTACTTCGCTTCGGGAACGGCACGGAACGGCACGCAAAGACTTTTCAA

Full Affymetrix probeset data:

Annotations for 1637612_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime