Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637614_s_at:

>probe:Drosophila_2:1637614_s_at:725:225; Interrogation_Position=109; Antisense; AAGGAACGCGATGTGGCACCCAGGC
>probe:Drosophila_2:1637614_s_at:11:619; Interrogation_Position=15; Antisense; TGCAGACCTCAAAATCATCCAGGAG
>probe:Drosophila_2:1637614_s_at:713:289; Interrogation_Position=163; Antisense; CGTCCGCCTGTGGTGACAGTAATGG
>probe:Drosophila_2:1637614_s_at:465:655; Interrogation_Position=182; Antisense; TAATGGGTCACGTGGATCATGGCAA
>probe:Drosophila_2:1637614_s_at:629:647; Interrogation_Position=198; Antisense; TCATGGCAAGACCACGCTCCTGGAT
>probe:Drosophila_2:1637614_s_at:661:9; Interrogation_Position=221; Antisense; ATTCCCTGCGAGGTGCTGATGTTGC
>probe:Drosophila_2:1637614_s_at:381:543; Interrogation_Position=263; Antisense; GGATTACCCAGCATATAGGCGCCTT
>probe:Drosophila_2:1637614_s_at:171:303; Interrogation_Position=283; Antisense; GCCTTTACCGTCACCTTGGAGAACG
>probe:Drosophila_2:1637614_s_at:662:107; Interrogation_Position=309; Antisense; AGAACGTGTCACTTTCCTGGATACA
>probe:Drosophila_2:1637614_s_at:563:589; Interrogation_Position=326; Antisense; TGGATACACCAGGACATGCTGCCTT
>probe:Drosophila_2:1637614_s_at:43:53; Interrogation_Position=341; Antisense; ATGCTGCCTTTAGCGCGATGCGAGC
>probe:Drosophila_2:1637614_s_at:261:151; Interrogation_Position=372; Antisense; ACATTATTGTCCTTGTGGTGGCCGC
>probe:Drosophila_2:1637614_s_at:130:465; Interrogation_Position=39; Antisense; GATTGCCAAGAAACTGGGTGCCAAA
>probe:Drosophila_2:1637614_s_at:141:533; Interrogation_Position=72; Antisense; GGTGGCCACACCTGAAGAAACAAAC

Paste this into a BLAST search page for me
AAGGAACGCGATGTGGCACCCAGGCTGCAGACCTCAAAATCATCCAGGAGCGTCCGCCTGTGGTGACAGTAATGGTAATGGGTCACGTGGATCATGGCAATCATGGCAAGACCACGCTCCTGGATATTCCCTGCGAGGTGCTGATGTTGCGGATTACCCAGCATATAGGCGCCTTGCCTTTACCGTCACCTTGGAGAACGAGAACGTGTCACTTTCCTGGATACATGGATACACCAGGACATGCTGCCTTATGCTGCCTTTAGCGCGATGCGAGCACATTATTGTCCTTGTGGTGGCCGCGATTGCCAAGAAACTGGGTGCCAAAGGTGGCCACACCTGAAGAAACAAAC

Full Affymetrix probeset data:

Annotations for 1637614_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime