FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637615_at:

>probe:Drosophila_2:1637615_at:675:563; Interrogation_Position=387; Antisense; GGAATCGTCCATCGGAGTGCTTCAC
>probe:Drosophila_2:1637615_at:335:433; Interrogation_Position=401; Antisense; GAGTGCTTCACGTTACGGATGCAGC
>probe:Drosophila_2:1637615_at:728:177; Interrogation_Position=469; Antisense; AAACTGGGTAGCGTCACCTGCTTCA
>probe:Drosophila_2:1637615_at:39:621; Interrogation_Position=524; Antisense; TGCTCGCTGGCTACGAATCGGGACA
>probe:Drosophila_2:1637615_at:719:285; Interrogation_Position=558; Antisense; CTGGGACATCAGCTCGAGCGTTATT
>probe:Drosophila_2:1637615_at:365:247; Interrogation_Position=596; Antisense; AATTGGCCCAAGATGCTACGTCTGT
>probe:Drosophila_2:1637615_at:475:39; Interrogation_Position=641; Antisense; ATCGTGGCATTGTGGGTGGTCCAAC
>probe:Drosophila_2:1637615_at:623:677; Interrogation_Position=678; Antisense; TAGTTTCAGTTATCAGCGCTCATCG
>probe:Drosophila_2:1637615_at:113:445; Interrogation_Position=702; Antisense; GATGCAAATGCAGCTCGGCTCGGAG
>probe:Drosophila_2:1637615_at:656:639; Interrogation_Position=716; Antisense; TCGGCTCGGAGCTGTGCATCAAGAA
>probe:Drosophila_2:1637615_at:496:233; Interrogation_Position=739; Antisense; AATCCTGGAGTGAATGGCGTTCGCA
>probe:Drosophila_2:1637615_at:137:455; Interrogation_Position=772; Antisense; GATCAGAAGGTGTTCGCCAGTGCCG
>probe:Drosophila_2:1637615_at:213:501; Interrogation_Position=806; Antisense; GTCGTATTCGGATCTTCTCGTGGAA
>probe:Drosophila_2:1637615_at:680:313; Interrogation_Position=953; Antisense; GCCAGATATCATTGTGGGACCTCTA

Paste this into a BLAST search page for me
GGAATCGTCCATCGGAGTGCTTCACGAGTGCTTCACGTTACGGATGCAGCAAACTGGGTAGCGTCACCTGCTTCATGCTCGCTGGCTACGAATCGGGACACTGGGACATCAGCTCGAGCGTTATTAATTGGCCCAAGATGCTACGTCTGTATCGTGGCATTGTGGGTGGTCCAACTAGTTTCAGTTATCAGCGCTCATCGGATGCAAATGCAGCTCGGCTCGGAGTCGGCTCGGAGCTGTGCATCAAGAAAATCCTGGAGTGAATGGCGTTCGCAGATCAGAAGGTGTTCGCCAGTGCCGGTCGTATTCGGATCTTCTCGTGGAAGCCAGATATCATTGTGGGACCTCTA

Full Affymetrix probeset data:

Annotations for 1637615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720