FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637617_at:

>probe:Drosophila_2:1637617_at:85:427; Interrogation_Position=151; Antisense; GAGATGATCTTTCCCAACTGCATTA
>probe:Drosophila_2:1637617_at:332:193; Interrogation_Position=166; Antisense; AACTGCATTAACCTGAAGCGCGTCA
>probe:Drosophila_2:1637617_at:22:445; Interrogation_Position=192; Antisense; GATGACCGCCAAACTAGAGCACGAG
>probe:Drosophila_2:1637617_at:86:257; Interrogation_Position=223; Antisense; CACAATCTTAGGCTCTTCCAGGAAG
>probe:Drosophila_2:1637617_at:309:719; Interrogation_Position=238; Antisense; TTCCAGGAAGCCTTCAATCGCTTGA
>probe:Drosophila_2:1637617_at:730:181; Interrogation_Position=271; Antisense; AAAACGGTACCAATCGATCGACTGA
>probe:Drosophila_2:1637617_at:202:203; Interrogation_Position=298; Antisense; AAGGGTCGCTTCCAGGACAACTTTG
>probe:Drosophila_2:1637617_at:700:191; Interrogation_Position=316; Antisense; AACTTTGAGTTCCTGCAGTGGTTCA
>probe:Drosophila_2:1637617_at:86:49; Interrogation_Position=395; Antisense; ATGCGCCGTTGGCAAAGCCCATAAA
>probe:Drosophila_2:1637617_at:214:119; Interrogation_Position=440; Antisense; AGCGATCACCAGTCAACGCCAATGA
>probe:Drosophila_2:1637617_at:35:549; Interrogation_Position=528; Antisense; GGAGGCCAGCAATCAGATCTACAAC
>probe:Drosophila_2:1637617_at:377:185; Interrogation_Position=550; Antisense; AACAAACTGCGCCTGGTCGAGGATT
>probe:Drosophila_2:1637617_at:18:177; Interrogation_Position=619; Antisense; AAACGCATTCAAGCGGTGCTCTACA
>probe:Drosophila_2:1637617_at:522:385; Interrogation_Position=712; Antisense; GAACACGCGGATCCCAATGACGGAT

Paste this into a BLAST search page for me
GAGATGATCTTTCCCAACTGCATTAAACTGCATTAACCTGAAGCGCGTCAGATGACCGCCAAACTAGAGCACGAGCACAATCTTAGGCTCTTCCAGGAAGTTCCAGGAAGCCTTCAATCGCTTGAAAAACGGTACCAATCGATCGACTGAAAGGGTCGCTTCCAGGACAACTTTGAACTTTGAGTTCCTGCAGTGGTTCAATGCGCCGTTGGCAAAGCCCATAAAAGCGATCACCAGTCAACGCCAATGAGGAGGCCAGCAATCAGATCTACAACAACAAACTGCGCCTGGTCGAGGATTAAACGCATTCAAGCGGTGCTCTACAGAACACGCGGATCCCAATGACGGAT

Full Affymetrix probeset data:

Annotations for 1637617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720