FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637618_at:

>probe:Drosophila_2:1637618_at:141:199; Interrogation_Position=1091; Antisense; AACGATCTGTACGATTTCGCGCTGG
>probe:Drosophila_2:1637618_at:38:333; Interrogation_Position=1111; Antisense; GCTGGCCCAATTCGAGTTCAACAAG
>probe:Drosophila_2:1637618_at:268:377; Interrogation_Position=1135; Antisense; GAAGAAGCTCATGCAGCCGGACAAC
>probe:Drosophila_2:1637618_at:588:261; Interrogation_Position=1148; Antisense; CAGCCGGACAACAAGCACGTGCAGA
>probe:Drosophila_2:1637618_at:450:215; Interrogation_Position=1187; Antisense; AAGATTCGGCCCAAATGATTGCAGA
>probe:Drosophila_2:1637618_at:387:463; Interrogation_Position=1237; Antisense; GATTCGGCCGACTCCAGTGATCTAA
>probe:Drosophila_2:1637618_at:90:85; Interrogation_Position=1252; Antisense; AGTGATCTAACCAGGAGTCTCCGAC
>probe:Drosophila_2:1637618_at:595:489; Interrogation_Position=1286; Antisense; GTAAATACGTAATTCTCCTTCGCAT
>probe:Drosophila_2:1637618_at:448:643; Interrogation_Position=1299; Antisense; TCTCCTTCGCATAGATTTGATCTGT
>probe:Drosophila_2:1637618_at:75:89; Interrogation_Position=1331; Antisense; AGTAACTCATCCGTACACTTAAGCG
>probe:Drosophila_2:1637618_at:32:423; Interrogation_Position=1446; Antisense; GAGAACGCTTTTGTAGTTCATCGTA
>probe:Drosophila_2:1637618_at:257:727; Interrogation_Position=1489; Antisense; TTGTCTGCACAATATCTCTATATGA
>probe:Drosophila_2:1637618_at:689:235; Interrogation_Position=1616; Antisense; AATCGACTCTCATTGTTTGTAACTC
>probe:Drosophila_2:1637618_at:328:691; Interrogation_Position=1631; Antisense; TTTGTAACTCTCATAGGCTAGGCCA

Paste this into a BLAST search page for me
AACGATCTGTACGATTTCGCGCTGGGCTGGCCCAATTCGAGTTCAACAAGGAAGAAGCTCATGCAGCCGGACAACCAGCCGGACAACAAGCACGTGCAGAAAGATTCGGCCCAAATGATTGCAGAGATTCGGCCGACTCCAGTGATCTAAAGTGATCTAACCAGGAGTCTCCGACGTAAATACGTAATTCTCCTTCGCATTCTCCTTCGCATAGATTTGATCTGTAGTAACTCATCCGTACACTTAAGCGGAGAACGCTTTTGTAGTTCATCGTATTGTCTGCACAATATCTCTATATGAAATCGACTCTCATTGTTTGTAACTCTTTGTAACTCTCATAGGCTAGGCCA

Full Affymetrix probeset data:

Annotations for 1637618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720