Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637621_at:

>probe:Drosophila_2:1637621_at:656:143; Interrogation_Position=1013; Antisense; ACTCTCAGCAAATAGCCGTCAGTCT
>probe:Drosophila_2:1637621_at:276:67; Interrogation_Position=1145; Antisense; ATGGCAGGTCGGCAAACTCCACAAA
>probe:Drosophila_2:1637621_at:240:257; Interrogation_Position=1176; Antisense; CACTTCATCCAAGCCAACAGATTTG
>probe:Drosophila_2:1637621_at:636:53; Interrogation_Position=1204; Antisense; ATGAACTCCTTAATTGTCGATCCCA
>probe:Drosophila_2:1637621_at:405:635; Interrogation_Position=1220; Antisense; TCGATCCCAAATCTTTTCTCACAAA
>probe:Drosophila_2:1637621_at:180:375; Interrogation_Position=1261; Antisense; GAAGTTCTGTCGGTTGATCAGGTTA
>probe:Drosophila_2:1637621_at:268:235; Interrogation_Position=1306; Antisense; AATCCAGATGTCTTCTCAAAGGCAC
>probe:Drosophila_2:1637621_at:408:73; Interrogation_Position=1336; Antisense; AGGAAACCAGCGACCAAGTCCAATA
>probe:Drosophila_2:1637621_at:564:677; Interrogation_Position=1359; Antisense; TAGAGGACCTGCTAAACACTTGCCA
>probe:Drosophila_2:1637621_at:448:395; Interrogation_Position=1388; Antisense; GAAATCGCATGCTTCAAACTATTCT
>probe:Drosophila_2:1637621_at:362:613; Interrogation_Position=1484; Antisense; TGAAAATTGATTCCCTTTGGTTTGG
>probe:Drosophila_2:1637621_at:273:49; Interrogation_Position=945; Antisense; ATCCAAAGCCTATCACATGCGCATT
>probe:Drosophila_2:1637621_at:238:11; Interrogation_Position=967; Antisense; ATTCGCTGCACCAAGAGTCCAATAT
>probe:Drosophila_2:1637621_at:21:47; Interrogation_Position=997; Antisense; ATCCAAATCAAATCCAACTCTCAGC

Paste this into a BLAST search page for me
ACTCTCAGCAAATAGCCGTCAGTCTATGGCAGGTCGGCAAACTCCACAAACACTTCATCCAAGCCAACAGATTTGATGAACTCCTTAATTGTCGATCCCATCGATCCCAAATCTTTTCTCACAAAGAAGTTCTGTCGGTTGATCAGGTTAAATCCAGATGTCTTCTCAAAGGCACAGGAAACCAGCGACCAAGTCCAATATAGAGGACCTGCTAAACACTTGCCAGAAATCGCATGCTTCAAACTATTCTTGAAAATTGATTCCCTTTGGTTTGGATCCAAAGCCTATCACATGCGCATTATTCGCTGCACCAAGAGTCCAATATATCCAAATCAAATCCAACTCTCAGC

Full Affymetrix probeset data:

Annotations for 1637621_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime