FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637623_at:

>probe:Drosophila_2:1637623_at:484:325; Interrogation_Position=264; Antisense; GCGAGAATCCTACACGAAGCCGAAA
>probe:Drosophila_2:1637623_at:370:227; Interrogation_Position=289; Antisense; AAGGCGCTTCTCTATGGAACGGGAA
>probe:Drosophila_2:1637623_at:664:563; Interrogation_Position=310; Antisense; GGAATGCTGTTCATGTACCAAGCCA
>probe:Drosophila_2:1637623_at:203:437; Interrogation_Position=352; Antisense; GAGGAGGCCTTTATGACTCTGCTAA
>probe:Drosophila_2:1637623_at:470:485; Interrogation_Position=409; Antisense; GTAGAACTTCAGAATCCCGTGTCCG
>probe:Drosophila_2:1637623_at:32:319; Interrogation_Position=433; Antisense; GCCGACTATCTGCTAACCTTGGAGA
>probe:Drosophila_2:1637623_at:471:179; Interrogation_Position=470; Antisense; AAAAGAAACTGCGTCTCCTTTCTCT
>probe:Drosophila_2:1637623_at:571:345; Interrogation_Position=497; Antisense; GCATCTGCACGATCCTTTGGGTGGA
>probe:Drosophila_2:1637623_at:97:131; Interrogation_Position=544; Antisense; ACCTATCCGGCCATCTGTGAATATA
>probe:Drosophila_2:1637623_at:364:21; Interrogation_Position=564; Antisense; ATATACCAACGTGGGCGTCTTCAAC
>probe:Drosophila_2:1637623_at:414:489; Interrogation_Position=580; Antisense; GTCTTCAACTTCCACGAACGGATCA
>probe:Drosophila_2:1637623_at:117:607; Interrogation_Position=660; Antisense; TGATGTCAACTACCTGTGATCCCAC
>probe:Drosophila_2:1637623_at:612:341; Interrogation_Position=700; Antisense; GCTTTCGTTATCCTTAAGACCGTGT
>probe:Drosophila_2:1637623_at:348:211; Interrogation_Position=715; Antisense; AAGACCGTGTTTGCTGCTTAAGTCA

Paste this into a BLAST search page for me
GCGAGAATCCTACACGAAGCCGAAAAAGGCGCTTCTCTATGGAACGGGAAGGAATGCTGTTCATGTACCAAGCCAGAGGAGGCCTTTATGACTCTGCTAAGTAGAACTTCAGAATCCCGTGTCCGGCCGACTATCTGCTAACCTTGGAGAAAAAGAAACTGCGTCTCCTTTCTCTGCATCTGCACGATCCTTTGGGTGGAACCTATCCGGCCATCTGTGAATATAATATACCAACGTGGGCGTCTTCAACGTCTTCAACTTCCACGAACGGATCATGATGTCAACTACCTGTGATCCCACGCTTTCGTTATCCTTAAGACCGTGTAAGACCGTGTTTGCTGCTTAAGTCA

Full Affymetrix probeset data:

Annotations for 1637623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720