FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637626_at:

>probe:Drosophila_2:1637626_at:174:299; Interrogation_Position=1046; Antisense; CGCTCATTGATCTCGACTGCTATAT
>probe:Drosophila_2:1637626_at:513:399; Interrogation_Position=1097; Antisense; GACACGCCAAGTTCCAGCAACTGGA
>probe:Drosophila_2:1637626_at:657:427; Interrogation_Position=1129; Antisense; GAGATTCTGAGCAGCGCCATTCTGA
>probe:Drosophila_2:1637626_at:354:609; Interrogation_Position=1151; Antisense; TGACCAGTTCTTTGAAGGCCTTCCT
>probe:Drosophila_2:1637626_at:699:641; Interrogation_Position=1175; Antisense; TCTGCAATTCCACCGATCTGAAGAG
>probe:Drosophila_2:1637626_at:665:547; Interrogation_Position=1278; Antisense; GGATGTGTGGTTCACTCTAGCGCCA
>probe:Drosophila_2:1637626_at:624:383; Interrogation_Position=1339; Antisense; GAACTGCAGTCCGTGGGTCAACTGA
>probe:Drosophila_2:1637626_at:320:631; Interrogation_Position=1356; Antisense; TCAACTGAACGGCTGGTCGCTGACG
>probe:Drosophila_2:1637626_at:139:605; Interrogation_Position=1386; Antisense; TGATTTGGCGCTGATTCGTGGACTC
>probe:Drosophila_2:1637626_at:318:639; Interrogation_Position=1401; Antisense; TCGTGGACTCCTCAAAAGCGGCAAT
>probe:Drosophila_2:1637626_at:427:399; Interrogation_Position=1440; Antisense; GACACCAAACGGTTTTCTAGCTTGA
>probe:Drosophila_2:1637626_at:352:83; Interrogation_Position=880; Antisense; AGGGCTCTTAGTACGCGCAATTTGC
>probe:Drosophila_2:1637626_at:296:587; Interrogation_Position=953; Antisense; TGGAGCGTCCGATTGGCAGGAATCT
>probe:Drosophila_2:1637626_at:246:565; Interrogation_Position=971; Antisense; GGAATCTGCGTCATCTCACCATGAT

Paste this into a BLAST search page for me
CGCTCATTGATCTCGACTGCTATATGACACGCCAAGTTCCAGCAACTGGAGAGATTCTGAGCAGCGCCATTCTGATGACCAGTTCTTTGAAGGCCTTCCTTCTGCAATTCCACCGATCTGAAGAGGGATGTGTGGTTCACTCTAGCGCCAGAACTGCAGTCCGTGGGTCAACTGATCAACTGAACGGCTGGTCGCTGACGTGATTTGGCGCTGATTCGTGGACTCTCGTGGACTCCTCAAAAGCGGCAATGACACCAAACGGTTTTCTAGCTTGAAGGGCTCTTAGTACGCGCAATTTGCTGGAGCGTCCGATTGGCAGGAATCTGGAATCTGCGTCATCTCACCATGAT

Full Affymetrix probeset data:

Annotations for 1637626_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720