Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637627_at:

>probe:Drosophila_2:1637627_at:506:157; Interrogation_Position=5491; Antisense; ACACAGTCCCATGCAGATACCGAAT
>probe:Drosophila_2:1637627_at:81:345; Interrogation_Position=5667; Antisense; GCTTGCTGCGGGAACATCTACATAT
>probe:Drosophila_2:1637627_at:359:505; Interrogation_Position=5758; Antisense; GTGCTGGATGTGATTTGTCTACGAA
>probe:Drosophila_2:1637627_at:542:221; Interrogation_Position=5781; Antisense; AAGTGGCACTCGGAGTTGCTGTCAA
>probe:Drosophila_2:1637627_at:696:427; Interrogation_Position=5808; Antisense; GAGTTGAGTTTGTTGCCCATATTCT
>probe:Drosophila_2:1637627_at:576:719; Interrogation_Position=5820; Antisense; TTGCCCATATTCTGCGGAGGATCGT
>probe:Drosophila_2:1637627_at:160:43; Interrogation_Position=5840; Antisense; ATCGTCGGCAGATTCATCCGTGGGA
>probe:Drosophila_2:1637627_at:502:229; Interrogation_Position=5866; Antisense; AATGGATGCGCTTTTTGGCCTGTGC
>probe:Drosophila_2:1637627_at:543:581; Interrogation_Position=5881; Antisense; TGGCCTGTGCCATGTGTGCGAGTAC
>probe:Drosophila_2:1637627_at:429:673; Interrogation_Position=5910; Antisense; TACCGCCTGTTTGCCATAGAGCTAA
>probe:Drosophila_2:1637627_at:393:117; Interrogation_Position=5938; Antisense; AGCTAGCCCGCTTATTTAATGTAAT
>probe:Drosophila_2:1637627_at:408:655; Interrogation_Position=5959; Antisense; TAATGCCGCCAAACTCTAGACCAAA
>probe:Drosophila_2:1637627_at:259:693; Interrogation_Position=6034; Antisense; TTTGTATCTGTACCTACCTGTATCC
>probe:Drosophila_2:1637627_at:475:285; Interrogation_Position=6051; Antisense; CTGTATCCCTGTACCTACTGTATAA

Paste this into a BLAST search page for me
ACACAGTCCCATGCAGATACCGAATGCTTGCTGCGGGAACATCTACATATGTGCTGGATGTGATTTGTCTACGAAAAGTGGCACTCGGAGTTGCTGTCAAGAGTTGAGTTTGTTGCCCATATTCTTTGCCCATATTCTGCGGAGGATCGTATCGTCGGCAGATTCATCCGTGGGAAATGGATGCGCTTTTTGGCCTGTGCTGGCCTGTGCCATGTGTGCGAGTACTACCGCCTGTTTGCCATAGAGCTAAAGCTAGCCCGCTTATTTAATGTAATTAATGCCGCCAAACTCTAGACCAAATTTGTATCTGTACCTACCTGTATCCCTGTATCCCTGTACCTACTGTATAA

Full Affymetrix probeset data:

Annotations for 1637627_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime