Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637628_at:

>probe:Drosophila_2:1637628_at:552:691; Interrogation_Position=1179; Antisense; TTTGTGGTTTCCCAACAGAGACAGA
>probe:Drosophila_2:1637628_at:618:103; Interrogation_Position=1218; Antisense; AGACGATGACCCTTTGCGCCAAATA
>probe:Drosophila_2:1637628_at:674:163; Interrogation_Position=1238; Antisense; AAATATCGCTTTCCCAGTCTGTTCA
>probe:Drosophila_2:1637628_at:635:499; Interrogation_Position=1254; Antisense; GTCTGTTCATCAATCAGTTCTTCCC
>probe:Drosophila_2:1637628_at:612:259; Interrogation_Position=1351; Antisense; CACGGATCTCTTCTACAGCTATGAA
>probe:Drosophila_2:1637628_at:722:395; Interrogation_Position=1397; Antisense; GAAATATACACCGTCTTGGTCACAG
>probe:Drosophila_2:1637628_at:646:373; Interrogation_Position=1421; Antisense; GAAGTTTCACACGACAAGCTCCATT
>probe:Drosophila_2:1637628_at:707:203; Interrogation_Position=1436; Antisense; AAGCTCCATTACGTGGGCCACAACA
>probe:Drosophila_2:1637628_at:613:85; Interrogation_Position=1474; Antisense; AGTACTGCTGCCCATGCGGGATAAC
>probe:Drosophila_2:1637628_at:525:527; Interrogation_Position=1491; Antisense; GGGATAACCTTCTTGGTACTCGTGT
>probe:Drosophila_2:1637628_at:575:537; Interrogation_Position=1505; Antisense; GGTACTCGTGTCCATGTGCGAATTA
>probe:Drosophila_2:1637628_at:15:255; Interrogation_Position=1655; Antisense; CAACGCTATTTTGGCATCGCTTTGG
>probe:Drosophila_2:1637628_at:72:593; Interrogation_Position=1683; Antisense; TGGGAAGTCTTGCTTTCCTCATACA
>probe:Drosophila_2:1637628_at:373:485; Interrogation_Position=1712; Antisense; GTAGTTCGACTCTTATAGCCACATC

Paste this into a BLAST search page for me
TTTGTGGTTTCCCAACAGAGACAGAAGACGATGACCCTTTGCGCCAAATAAAATATCGCTTTCCCAGTCTGTTCAGTCTGTTCATCAATCAGTTCTTCCCCACGGATCTCTTCTACAGCTATGAAGAAATATACACCGTCTTGGTCACAGGAAGTTTCACACGACAAGCTCCATTAAGCTCCATTACGTGGGCCACAACAAGTACTGCTGCCCATGCGGGATAACGGGATAACCTTCTTGGTACTCGTGTGGTACTCGTGTCCATGTGCGAATTACAACGCTATTTTGGCATCGCTTTGGTGGGAAGTCTTGCTTTCCTCATACAGTAGTTCGACTCTTATAGCCACATC

Full Affymetrix probeset data:

Annotations for 1637628_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime