Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637631_at:

>probe:Drosophila_2:1637631_at:151:477; Interrogation_Position=4057; Antisense; GTTATCAGTTTTGTTTGCATTCCAT
>probe:Drosophila_2:1637631_at:645:617; Interrogation_Position=4072; Antisense; TGCATTCCATTACTTAAGCCTTCTG
>probe:Drosophila_2:1637631_at:502:659; Interrogation_Position=4086; Antisense; TAAGCCTTCTGTTCGTATCATTGGG
>probe:Drosophila_2:1637631_at:431:721; Interrogation_Position=4106; Antisense; TTGGGCCTACGGTATGATTTCTGTA
>probe:Drosophila_2:1637631_at:556:491; Interrogation_Position=4128; Antisense; GTAAACTCAATCTGGCTTCATAGCG
>probe:Drosophila_2:1637631_at:620:353; Interrogation_Position=4157; Antisense; GCAGCCTGTTTGTTTTCGAATTCAT
>probe:Drosophila_2:1637631_at:245:7; Interrogation_Position=4193; Antisense; ATTACTTACTAGTTGTTGCCACTTT
>probe:Drosophila_2:1637631_at:470:199; Interrogation_Position=4243; Antisense; AACGCAATCGATTAAGCTCTGTCCC
>probe:Drosophila_2:1637631_at:138:391; Interrogation_Position=4282; Antisense; GAAACCCCTTTTCGCAACCAATATG
>probe:Drosophila_2:1637631_at:42:205; Interrogation_Position=4297; Antisense; AACCAATATGAATCTGCCGGCTAAA
>probe:Drosophila_2:1637631_at:726:227; Interrogation_Position=4339; Antisense; AATGCCAGGGCCAGAGGACCAGTAT
>probe:Drosophila_2:1637631_at:722:71; Interrogation_Position=4368; Antisense; AGGACATCCATTATTTGACGCCCGC
>probe:Drosophila_2:1637631_at:146:333; Interrogation_Position=4391; Antisense; GCTGGCTTTAATGCAATCGAATCAA
>probe:Drosophila_2:1637631_at:329:21; Interrogation_Position=4459; Antisense; ATATCGAACCTCTGTCTCTGCTTTT

Paste this into a BLAST search page for me
GTTATCAGTTTTGTTTGCATTCCATTGCATTCCATTACTTAAGCCTTCTGTAAGCCTTCTGTTCGTATCATTGGGTTGGGCCTACGGTATGATTTCTGTAGTAAACTCAATCTGGCTTCATAGCGGCAGCCTGTTTGTTTTCGAATTCATATTACTTACTAGTTGTTGCCACTTTAACGCAATCGATTAAGCTCTGTCCCGAAACCCCTTTTCGCAACCAATATGAACCAATATGAATCTGCCGGCTAAAAATGCCAGGGCCAGAGGACCAGTATAGGACATCCATTATTTGACGCCCGCGCTGGCTTTAATGCAATCGAATCAAATATCGAACCTCTGTCTCTGCTTTT

Full Affymetrix probeset data:

Annotations for 1637631_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime