FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637632_at:

>probe:Drosophila_2:1637632_at:495:715; Interrogation_Position=1309; Antisense; TTCTGGCTGCAGGTATTCTTCATGT
>probe:Drosophila_2:1637632_at:291:261; Interrogation_Position=1359; Antisense; CACCTGTGCGATTTGGGCCTACAAC
>probe:Drosophila_2:1637632_at:589:27; Interrogation_Position=1431; Antisense; ATACCACACCTCGATGTACGTGAAT
>probe:Drosophila_2:1637632_at:702:59; Interrogation_Position=1482; Antisense; ATGTCTTGCTGTTGTGTTCTAATCC
>probe:Drosophila_2:1637632_at:126:23; Interrogation_Position=1508; Antisense; ATATCCGATGATGACACTTCTCCAC
>probe:Drosophila_2:1637632_at:593:711; Interrogation_Position=1533; Antisense; TTCAGCCCCTGACTAATTAACGTTC
>probe:Drosophila_2:1637632_at:69:187; Interrogation_Position=1620; Antisense; AACAGGCGGCCTTTATTGGGCAACT
>probe:Drosophila_2:1637632_at:625:449; Interrogation_Position=1655; Antisense; GATCGATTCTGTTTGTTACTAACCA
>probe:Drosophila_2:1637632_at:533:247; Interrogation_Position=1686; Antisense; AATTGCGATGCTAATGCCATTTCCA
>probe:Drosophila_2:1637632_at:556:307; Interrogation_Position=1702; Antisense; CCATTTCCACTACACTTGACTTGTT
>probe:Drosophila_2:1637632_at:370:681; Interrogation_Position=1726; Antisense; TATGCAACTCGGAGCACATTCTGCT
>probe:Drosophila_2:1637632_at:167:673; Interrogation_Position=1750; Antisense; TAGCCGCACAATCGACGTGGTCATT
>probe:Drosophila_2:1637632_at:443:537; Interrogation_Position=1768; Antisense; GGTCATTCGATCTATTTTACTCCTC
>probe:Drosophila_2:1637632_at:524:305; Interrogation_Position=1789; Antisense; CCTCCTAGCCAACGTTCTATGATGA

Paste this into a BLAST search page for me
TTCTGGCTGCAGGTATTCTTCATGTCACCTGTGCGATTTGGGCCTACAACATACCACACCTCGATGTACGTGAATATGTCTTGCTGTTGTGTTCTAATCCATATCCGATGATGACACTTCTCCACTTCAGCCCCTGACTAATTAACGTTCAACAGGCGGCCTTTATTGGGCAACTGATCGATTCTGTTTGTTACTAACCAAATTGCGATGCTAATGCCATTTCCACCATTTCCACTACACTTGACTTGTTTATGCAACTCGGAGCACATTCTGCTTAGCCGCACAATCGACGTGGTCATTGGTCATTCGATCTATTTTACTCCTCCCTCCTAGCCAACGTTCTATGATGA

Full Affymetrix probeset data:

Annotations for 1637632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720