Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637633_at:

>probe:Drosophila_2:1637633_at:228:635; Interrogation_Position=1088; Antisense; TCGCCAACGATATCCGATTGCTGGG
>probe:Drosophila_2:1637633_at:72:623; Interrogation_Position=1126; Antisense; TGCGGTCTGGGCGAACTAATGCTGC
>probe:Drosophila_2:1637633_at:470:239; Interrogation_Position=1208; Antisense; AATCAATGACCATGCTGTGTGCCCA
>probe:Drosophila_2:1637633_at:327:283; Interrogation_Position=1269; Antisense; CTCCAACGGGCACTTCGAGCTAAAT
>probe:Drosophila_2:1637633_at:182:663; Interrogation_Position=1289; Antisense; TAAATGTATTCAAACCCCTGGTCGT
>probe:Drosophila_2:1637633_at:524:273; Interrogation_Position=1332; Antisense; CATTCGCTTGTTGGGTGAGTCGGAA
>probe:Drosophila_2:1637633_at:37:191; Interrogation_Position=1377; Antisense; AACATGCATACATAACCTTCTCCTC
>probe:Drosophila_2:1637633_at:632:439; Interrogation_Position=1408; Antisense; GATGGCAGCATGACCTTCAGCAAGA
>probe:Drosophila_2:1637633_at:485:453; Interrogation_Position=1476; Antisense; GATCATGAACGAGTCCTTGATGCTG
>probe:Drosophila_2:1637633_at:527:725; Interrogation_Position=1492; Antisense; TTGATGCTGGTGACCGCGCTGAATC
>probe:Drosophila_2:1637633_at:428:583; Interrogation_Position=1524; Antisense; TGGCTATGACAAGGCCGCCCTGATC
>probe:Drosophila_2:1637633_at:727:437; Interrogation_Position=1588; Antisense; GAGGCACTGAAGACCGGAATTACCG
>probe:Drosophila_2:1637633_at:226:113; Interrogation_Position=1618; Antisense; CAGTTCAAGGAGTGGGTCAATCCCA
>probe:Drosophila_2:1637633_at:54:447; Interrogation_Position=1647; Antisense; GATGCTGGGACCGAAGTGATTCGCT

Paste this into a BLAST search page for me
TCGCCAACGATATCCGATTGCTGGGTGCGGTCTGGGCGAACTAATGCTGCAATCAATGACCATGCTGTGTGCCCACTCCAACGGGCACTTCGAGCTAAATTAAATGTATTCAAACCCCTGGTCGTCATTCGCTTGTTGGGTGAGTCGGAAAACATGCATACATAACCTTCTCCTCGATGGCAGCATGACCTTCAGCAAGAGATCATGAACGAGTCCTTGATGCTGTTGATGCTGGTGACCGCGCTGAATCTGGCTATGACAAGGCCGCCCTGATCGAGGCACTGAAGACCGGAATTACCGCAGTTCAAGGAGTGGGTCAATCCCAGATGCTGGGACCGAAGTGATTCGCT

Full Affymetrix probeset data:

Annotations for 1637633_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime